![]() |
|
|
Vol. 295, Issue 2, 655-661, November 2000
Janssen Research Foundation, Beerse, Belgium
| |
Abstract |
|---|
|
|
|---|
Interleukin (IL)-5 regulates the growth, differentiation, and
activation of eosinophils. When activated, eosinophils release an array
of proinflammatory and cytotoxic products and act as prominent effector
cells in the process of allergic inflammation. Depriving eosinophils of
IL-5 may therefore represent a viable approach to treat allergic
disorders. This study describes the identification of R146225, a novel
six-substituted azauracil derivative, as a potent, orally active
inhibitor of IL-5 biosynthesis, capable of reducing pulmonary
eosinophilia in mice. In vitro, R146225 inhibited IL-5 protein
formation by activated human whole blood (IC50 = 34 nM), human peripheral blood mononuclear cells (IC50 = 24 nM), and murine spleen cells (IC50 = 6 nM). In
contrast, the compound enhanced generation of interferon-
and
had little or no inhibitory effect on the production of IL-2 and IL-4.
Reverse transcription-polymerase chain reaction analysis of stimulated whole blood cells indicated R146225's ability to down-regulate IL-5
mRNA expression. In vivo p.o. administration of R146225 (2.5 mg/kg) to
mice before an i.v. anti-CD3 antibody challenge reduced IL-5 but
enhanced interferon-
serum levels, without affecting IL-2 and IL-4
production. Analogous to the in vitro results, R146225 suppressed
splenic IL-5 mRNA expression, while message levels of the other
cytokines remained unchanged. Moreover, p.o. dosing of R146225
(0.6-2.5 mg/kg) dose dependently reduced the pulmonary accumulation of
eosinophils induced in mice by an intranasal instillation of
Cryptococcus neoformans. Based on these data, R146225
may be useful in the therapy of eosinophil-driven allergic conditions.
| |
Introduction |
|---|
|
|
|---|
Increased
accumulation of eosinophils in blood and inflamed tissues is a
characteristic feature of the major allergic diseases, viz., asthma,
rhinitis, and atopic dermatitis (Costa et al., 1997
). The ability of
eosinophils to synthesize and release a series of proinflammatory and
cytotoxic products, such as basic granule proteins, proteases, sensory
neuropeptides, leukotrienes, oxygen radicals, and cytokines, has
incriminated these polymorphonuclear leukocytes as principal effector
cells in the inflammatory process of allergy (Giembycz and Lindsay,
1999
). For their growth, differentiation, activation, and survival,
eosinophils are dependent on the availability of T-cell-derived
hematopoietic cytokines, such as
granulocyte-macrophage-colony-stimulating factor, IL-3, and IL-5
(Humbert, 1996
). Of these proteins, IL-5 stands out for its
nonredundant and eosinophil-dedicated activities (Egan et al., 1996
;
Hogan and Foster, 1996
; Sehmi and Denburg, 1999
). In bone marrow, IL-5
is the sole cytokine that regulates the final step of eosinophil
differentiation and controls the entry of matured eosinophils to the
bloodstream. In blood, IL-5 primes blood-borne eosinophils for
adherence to and transmigration through the vascular endothelium. In
tissues, IL-5 acts as a survival factor for eosinophils by delaying
their apoptotic death. Numerous studies using IL-5 transgenic mice or
animals treated with neutralizing anti-IL-5 antibodies have
corroborated the key role of IL-5 in the process of eosinophilia,
inflammation, and/or tissue alterations in response to an allergic
challenge (Egan et al., 1996
; Hogan and Foster, 1997
; Lee et al., 1997
;
Hamelmann and Gelfand, 1999
). Moreover, clinical studies in humans have
indicated an interdependency between the level of IL-5 mRNA/protein
expression, eosinophilia, and/or allergic symptoms (Robinson et al.,
1993
; Egan et al., 1996
; Humbert et al., 1997
; Kimura et al.,
1998
; Masuyama et al., 1998
). All in all, the central position
of eosinophils in the process of allergic inflammation, together with
the selective effect of IL-5 on eosinopoiesis, identifies this cytokine
as a viable target for the treatment of asthma and allergic diseases (Hogan and Foster, 1997
; Okudaira and Mori, 1998
; Lalani et al., 1999
).
Among the several potential strategies to target IL-5 (Minnicozzi, 1999
), we opted for the development of orally active inhibitors of IL-5
production. By compound library screening using the phytohemagglutinin (PHA)-stimulated human whole blood assay (Van Wauwe et al., 1995
), we
hit upon a series of six-substituted azauracil derivatives with
micromolar IL-5-inhibiting potency. Subsequent targeted chemical synthesis resulted in R146225 or
(A)-(
)-2-[3,5-dichloro-4-[(4-chlorophenyl)(2-pyrimidinylthio)methyl]phenyl-1,2,4-triazine-3,5(2H,4H)dione, now identified as a potent, orally active inhibitor of IL-5 protein production and IL-5 mRNA expression. The chemical structure of R146225
is depicted in Fig. 1.
|
| |
Materials and Methods |
|---|
|
|
|---|
Animals. Female Balb/c and C57Bl/6 mice (20-22 g) were obtained from Iffa Credo (Brussels, Belgium) and Charles River (Sulzfeld, Germany), respectively. The animals were housed in an air conditioned room at 21°C (12-h light/dark cycle) and provided with food and water ad libitum.
Chemicals. R146225 was synthesized at the Department of Medicinal Chemistry, Janssen Research Foundation (Beerse, Belgium) according to methods described in patent application WO 9902504. For in vitro experiments, the compound was dissolved at 5 mM in dimethyl sulfoxide and appropriately diluted with culture medium so that the final dimethyl sulfoxide concentration was maintained at 0.2%. Culture medium consisted of RPMI 1640 supplemented with 2 mM glutamine, 100 U/ml penicillin, and 10 µg/ml streptomycin. PHA was obtained from Murex (Dartfort, UK). The hamster anti-mouse CD3 antibody (anti-CD3) was isolated by protein A-Sepharose affinity chromatography from supernatants of clone 154-2C11 hybridoma cells, obtained from the American Type Culture Collection (Rockville, MD). Anti-human CD28 antibody (anti-CD28) was purchased from Serotec (Oxford, UK). For in vivo experiments, R146225 was suspended in a 1% solution of Tween 80 (Sigma, Bornem, Belgium) in water and orally administered to mice in a volume of 0.1 ml/10 g of body weight.
In Vitro Cytokine Production.
Blood from adult healthy
donors was drawn into heparinized syringes (12.5 U of heparin/ml), and
cultured as described (Van Wauwe et al., 1995
). Briefly, blood samples
were 3-fold diluted in culture medium and 300-µl fractions were
cultured with 100 µl of PHA (final concentration 5 µg/ml) and 100 µl of R146225 (final concentration 1-1000 nM). Human peripheral
blood mononuclear cells (PBMCs) were isolated by density gradient
centrifugation (Lymphoprep; Nycomed Pharma, Oslo, Norway) and suspended
at a density of 2 × 106 cells/ml in culture
medium containing 10% heat-inactivated fetal calf serum. PBMCs (100 µl) were cultured after addition of 50 µl of R146225 (final
concentration 1-1000 nM) and 50 µl of a mixture of PHA (final
concentration 5 µg/ml) and anti-CD28 (final concentration 1 µg/ml).
Mouse spleen cells were prepared as described (Cools et al., 1992
) and
suspended at a density of 6 × 106/ml in
culture medium containing 50 µM 2-mercaptoethanol (Sigma) and 5%
heat-inactivated fetal calf serum (Life Technologies, Merelbeke, Belgium). Splenocytes (100 µl) were cultured together with 50 µl of
R146225 (final concentration 1-1000 nM) and 50 µl of anti-CD3 (final
concentration 5 µg/ml). All cultures were performed at 37°C in a
humidified 6% CO2 atmosphere. At the specified
times, cell supernatants were harvested for cytokine protein
determinations and cellular RNA was isolated for cytokine mRNA measurements.
In Vivo Cytokine Production.
Balb/c mice were treated orally
with R146225 or vehicle (1% Tween 80) 1 h before an i.v.
challenge with 0.2 ml of saline containing 2.5 µg of anti-CD3. At
indicated times after the antibody challenge, blood samples were
obtained and allowed to clot overnight at 4°C. Serum samples were
then stored at
20°C until tested for the presence of cytokines. In
some experiments, spleens were excised and homogenized in RNA lysis
buffer to isolate cellular RNA.
Cryptococcus neoformans-Induced Lung
Eosinophilia.
Cryptococcus neoformans strain RV 11852 (ATCC 32265) was obtained from the American Type Culture Collection.
For infection, yeasts were grown at 37°C for 92 h on Sabouraud
agar [4% D-glucose, 1% peptone (Oxoid,
Basingstoke, UK) and 2% Bitek agar (Difco, Detroit, MI)]. Cells were
washed with saline, counted, and diluted to 2 × 105 CFU/ml in saline. C57Bl/6 mice were
anesthetized by i.p. injection of 50 mg/kg pentobarbital (Nembutal;
Sanofi, Brussels, Belgium) and intranasally inoculated with
104 CFU of C. neoformans. Fourteen
days later, the animals were sacrificed. Their lungs were excised,
minced, and processed as described (Huffnagle et al., 1998
). The total
number of lung leukocytes was determined by flow cytometry on a Cytoron
Absolute (Ortho Diagnostic Systems, Raritan, NJ). To enumerate the
number of eosinophils, lymphocytes, neutrophils, and macrophages,
samples of the cell suspensions (1.5 × 105
lung leukocytes) were spun down onto glass slides (Shandon Cytospin, Pittsburgh, PA) and stained with Diff-Quick whole blood stain (Dade
Behring, Marburg, Germany). A total of 200 to 400 cells/sample was
counted. To assess the effect of R146225 on pulmonary cell composition,
the compound (0.16-2.5 mg/kg) was p.o. administered once daily from
day 3 up to 13 after infection. Preliminary experiments have indicated
that R146225 treatment did not interfere with lung colonization by
C. neoformans: CFU per lung, at day 14 post infection, were
5.7 ± 0.1 × 105 and 5.7 ± 0.1 × 105 in vehicle- or R146225 (10 mg/kg)-treated mice, respectively.
Cytokine Measurements.
Cytokine protein concentrations were
determined by sandwich ELISA as described (Van Wauwe et al., 1995
).
Murine monoclonals used as capture antibodies to human cytokines were
obtained from R&D Systems (Abingdon, UK) and code named MAB 202, 204, 205, and 285 for IL-2, IL-4, IL-5, and IFN-
, respectively.
Biotinylated goat polyclonal antibodies used to detect human cytokines
were from R&D Systems (BAF 202, 204, 205, and 285). Rat monoclonals to
capture mouse cytokines were purchased from Pharmingen (Becton Dickinson, Erembodegem, Belgium) [clones JES6-1A12 (IL-2), 11B11 (IL-4), TRFK5 (IL-5), and R4-6A2 (IFN-
)]. Biotinylated rat
monoclonal antibodies to detect murine cytokines were from Pharmingen
[clones JES6-5H4 (IL-2), BVD6-24G2 (IL-4), TRFK4 (IL-5), and XMG1.2
(IFN-
)]. Cytokine levels were calculated from standard curves using
recombinant human and murine cytokines supplied by R&D Systems and
Pharmingen, respectively. Validation experiments indicated that, for
each cytokine tested, standard curves were unaffected by the presence of 1 µM R146225.
RNA Extraction and Reverse Transcription-PCR.
Cellular RNA
was prepared by homogenizing pelleted whole blood cells [after lysis
of erythrocytes with red blood cell lysis buffer (Boehringer-Mannheim,
Brussels, Belgium)] or mouse spleen in 1 ml of Ultraspec-II RNA lysis
buffer, followed by RNA extraction according to the manufacturer's
instructions (Biotecx Laboratories, Houston, TX). RNA content was
determined by the absorbance measurement at 260 nm. Analysis for the
presence of mRNAs was carried out using the Titan One Tube reverse
transcription-PCR system (Roche Molecular Biochemicals, Brussels,
Belgium). Briefly, 200 ng of RNA was reverse transcribed and amplified
in 50 µl of reverse transcription-PCR buffer (20 mM Tris-HCl, pH 7.5, 100 mM KCl, 1.5 mM MgCl2) containing 0.2 mM dNTP,
5 mM dithiothreitol, 8 U of RNase inhibitor, enzyme mix
(AMV reverse transcription and Expand High Fidelity enzymes),
and 0.4 µM 5'- and 3'-specific primers for the human or murine
cytokine genes under consideration. To account for quantitative and/or
qualitative differences in the RNA preparation, primers for the
-actin gene were used in each experiment. Samples were transferred
to a thermocycler (PCT-200 Peltier thermal cycler; MJ Research,
Watertown, MA); incubated at 50°C for 30 min; and subjected to a
denaturation step (94°C, 2 min) and to 26 to 32 cycles consisting of
30 s at 94°C, 1 min at 55°C, and 30 s at 72°C, followed
by a final elongation step op 4 min at 72°C. After amplification, 15 µl of PCR product was mixed with 3 µl of gel loading buffer (0.25%
bromophenol blue, 0.25% xylene cyanol, 30% glycerol in water),
electrophoresed in a 2% agarose gel at 60 V, and visualized by UV
light illumination after ethidium bromide staining and quantified using
the Lumi-Imagen F1 Workstation (Roche Molecular Biochemicals).
: 5' primer, AGTTATATCTTGGCTTTTCA and 3' primer,
ACCGAATAATTAGTCAGCTT; mouse IL-2: 5' primer,
ACTTCAAGCTCCACTTCAAGC and 3' primer, GCTTTGAGAAAGGGCTATCCA; mouse IL-4:
5' primer, GAATGTACCAGCAAGCCATATC and 3' primer, CTCAGTACTACGAGTAATCCA; mouse IL-5: 5' primer, AAGATGCTTCTGCACTTGA and 3' primer,
GAACTCTTGCAAGGTAATCCAGG; mouse IFN-
: 5' primer,
AACGCTTACACACTGCATCTTGG and 3' primer, GACTTCAAAGAGTCTGAGG; and
-actin: 5' primer, GGGTCAGAAGGATTCCTATG and 3' primer, GGTCTCAAACATGATCTGGG.
Data Analysis. Data are expressed as mean ± S.E. The 50% inhibition concentrations (IC50) were calculated by probit analysis. Comparisons between two groups were performed by Student's t test and among three or more groups by Dunnett's test.
| |
Results |
|---|
|
|
|---|
Effect of R146225 on In Vitro IL-5 Protein Production.
To
determine the inhibiting activity of R146225 on IL-5 protein
production, cultures of human whole blood, human PBMCs, and mouse
splenocytes were preincubated for 30 min with or without R146225
(1-1000 nM), and stimulated by the addition of PHA, PHA + anti-CD28,
or anti-CD3, respectively. At 48 h after stimulation, supernatant
levels of IL-5 were assessed by ELISA. As shown in Fig.
2, R146225 potently inhibited the IL-5
production by stimulated cultures of human whole blood
(IC50 = 34 ± 10 nM), human PBMCs (IC50 = 24 ± 8 nM), and mouse splenocytes
(IC50 = 6 ± 2 nM).
|
Effects of R146225 on In Vitro IL-2, IL-4, and IFN-
Protein
Production.
To determine the cytokine specificity of R146225, we
compared its effects on the production of IL-2, IL-4, IL-5, and IFN-
by activated human whole blood, human PBMCs, and mouse splenocyte cultures. Cells were activated in the absence or presence of R146225 (1 µM) and supernatants were recovered at the time of maximal cytokine
production, i.e., 24 h for IL-2 and 48 h for IL-4, IL-5, and
IFN-
. As shown in Fig. 3, in
conditions where R146225 markedly (65-85% inhibition) suppressed the
IL-5 production, the compound had no or only partial effects on the
biosynthesis of IL-2 (13-25% reduction) and IL-4 (8-30%). In
contrast, in the presence of R146225, generation of IFN-
by
activated whole blood, PMBCs, and splenocyte cultures was enhanced by
12 ± 4, 20 ± 6, and 57 ± 8%, respectively.
|
Effect of R146225 on In Vitro Cytokine mRNA Expression.
To
assess the potential effects of R146225 on cytokine production at the
mRNA level, PHA-stimulated or unstimulated whole blood was cultured for
4, 12, and 16 h with or without R146225 (1 µM). Cellular RNA was
extracted and reverse transcription-PCR analyzed for mRNA levels of
IL-2, IL-4, IL-5, IFN-
, and the housekeeping gene
-actin. The
results are shown in Fig. 4. Unstimulated
whole blood cells did not contain detectable levels of cytokine mRNA, but PHA stimulation induced a rapid (6-h time point) and stable (12- and 24-h) expression of IL-2, IL-4, and IFN-
transcripts. In
contrast, IL-5 mRNA expression only gradually increased from a barely
detectable (at 6 h) to abundant levels (at 24 h). At this
latter time point, R146225 markedly (>80% inhibition) down-regulated the IL-5 message. Except for a modest inhibition (by ~30%) on IL-4
mRNA expression at 16 and 24 h, R146225 did not affect gene expression of IL-2, IFN-
, or
-actin.
|
Effect of R146225 on IL-5 Protein Production In Vivo.
To
establish the in vivo IL-5-reducing activity of R146225, mice were p.o.
treated with vehicle (1% Tween 80) or R146225 (2.5 mg/kg). One hour
later, the animals were i.v. injected with anti-CD3 (2.5 µg/mouse).
Two, 4, 6, 8, and 12 h later, serum IL-5 levels were measured by
ELISA. As shown in Fig. 5, R146225 caused
a partial (40-60%) inhibition of IL-5 production at 6, 8, and 12 h after antibody treatment, but was without effect at the 2- and 4-h
time points. To determine the compound's potency, mice were p.o.
treated with vehicle or graded doses of R146225 (0.04-10 mg/kg) before (
1 h) an i.v. challenge with anti-CD3. Six hours later, the level of
circulating IL-5 was determined. Figure 6
shows that R146225 pretreatment significantly reduced IL-5 production
after administration of doses between 10 mg/kg (46 ± 9%
inhibition) and 0.16 mg/kg (29 ± 9% inhibition).
|
|
Effect of R146225 on IL-2, IL-4, and IFN-
Protein Production In
Vivo.
To determine the in vivo cytokine selectivity of the test
compound, mice were p.o. treated with vehicle or R146225 (2.5 mg/kg) and, 1 h later, i.v. injected with anti-CD3. At the time of
maximal serum production (2 h for IL-2, IL-4, and IFN-
and 6 h
for IL-5 as determined in preliminary time course experiments), serum
levels of the cytokines were assessed (Fig.
7). Whereas R146225 significantly attenuated serum IL-5 levels by 47 ± 4%, it had no effect on the anti-CD3-induced serum levels of IL-2 and IL-4. However, R146225 virtually doubled (from 12,600 to 23,100 pg/ml) the serum production of
IFN-
.
|
Effect of R146225 on IL-2, IL-4, IL-5, and IFN-
mRNA Expression
In Vivo.
To establish whether R146225 affected the in vivo
cytokine mRNA levels, mice were p.o. treated with vehicle or R146225
(2.5 mg/kg), before (
1 h) an i.v. injection with anti-CD3. After
another 1.5 or 5 h, spleens were excised, RNA was isolated, and
the level of cytokine and
-actin mRNA was evaluated by reverse
transcription-PCR. Figure 8 shows that
treatment with R146225 strongly (>80% inhibition) suppressed the
anti-CD3-induced splenic accumulation of IL-5 mRNA, without affecting
the mRNA levels of the other cytokines or
-actin.
|
Effect of R146225 on Lung Eosinophilia in C.
neoformans-Infected Mice.
To determine the action of
R146225 in an IL-5-driven disease model (Huffnagle et al.,
1998
), we evaluated its effects on the pulmonary accumulation of
eosinophils induced in mice by an intranasal infection with C. neoformans. As shown in Table 1, at
day 14 post infection, lungs from infected, vehicle-treated animals
contained significantly increased numbers of eosinophils (18.2 × 106 compared with 0.5 × 106 in uninfected, vehicle-treated controls,
P < .01) and macrophages (7.2 × 106 versus 1.6 × 106,
P < .01), but similar quantities of lymphocytes
(28.3 × 106 versus 31.5 × 106) and neutrophils (3.5 × 106 versus 3.9 × 106). Oral treatment with 0.6 and 2.5 mg/kg
R146225, between day 3 and 13 after infection suppressed eosinophil
influx by 50 ± 9 and 52 ± 6%, respectively. The compound
had no effect on C. neoformans-induced recruitment of
lymphocytes, neutrophils, or macrophages.
|
| |
Discussion |
|---|
|
|
|---|
Considering the prominent role that the eosinopoietic cytokine IL-5 plays in the pathogenesis of allergic disorders, we initiated a screening program to hit upon novel IL-5-inhibiting compounds This effort eventually led to the identification of R146225 as an in vitro and in vivo inhibitor of IL-5 protein synthesis and mRNA expression, capable of reducing the pulmonary accumulation of eosinophils in C. neoformans-infected mice.
Our in vitro data indicate that R146225 acted as a potent inhibitor of
IL-5 protein formation. Irrespective of the used cell system (human
whole blood, human PBMCs, mouse splenocytes) or stimulating agent (PHA,
PHA + anti-CD28 antibody, anti-CD3 antibody), submicromolar
concentrations of R146225 suppressed by more than 70% the IL-5 protein
levels in the cell supernatants. R146225 reduced only modestly (by less
than 30%) the production of IL-2 and IL-4, but it enhanced IFN-
protein formation, weakly (10-30% increase) in the human cell
systems, but more strongly (50-65% enhancement) in mouse splenocyte
cultures. This pattern of cytokine modulation clearly differentiates
R146225 from other known IL-5-inhibiting compounds. For instance, the
corticosteroid dexamethasone or the phosphodiesterase 4 inhibitor
rolipram suppresses with comparable potency the production of IL-5,
IL-2, and IFN-
(Van Wauwe et al., 1995
), whereas the T-cell
immunosuppressants cyclosporin and FK506 down-regulate the
production of IL-2, IL-4, and IFN-
more strongly than that of IL-5
(Pacocha et al., 1999
). Also the two recently described
IL-5-inhibiting/IFN-
-enhancing compounds PNU-142731A and
M50367 are different from R146225 because they also suppress the
production of IL-4, IL-6, and IgE (Chin et al., 1999
; Kato et al.,
1999
). Curiously, for both R146225 and the above-mentioned
anti-inflammatory compounds (Rolfe et al., 1992
, 1997
; Foissier et al.,
1996
; Barnette et al., 1998
; Pacocha et al., 1999
), inhibition of IL-5
protein production was preceded by a reduction of IL-5 mRNA expression.
How R146225 reduces IL-5 mRNA expression is unclear. Acceleration of
IL-5 mRNA degradation by R146225 appears unlikely: such action goes
counter to the high stability of IL-5 transcripts (Umland et al.,
1998
) and, indeed, pulse-chase experiments using IL-5-producing
activated murine EL-4 thymoma cells indicated that R146225 did not
alter the IL-5 mRNA decay rate (J. Van Wauwe, unpublished data).
Also because IL-5 protein synthesis is primarily regulated at the
transcriptional level (Rolfe and Sewell, 1997
), it appears more
plausible that R146225 affects the process of IL-5 gene transcription.
Recent data on the nuclear pathways regulating the human IL-5 gene have revealed the presence of multiple regulatory elements in the
5'-flanking region of this gene. This region contains positive
regulatory elements, such as a conserved lymphokine element O, that
interact with the transcription factors Oct1, Oct2, Ets1, and Ets2, and activator protein-1 members JunD and Fra-2 (Schwenger et al., 1999
), a
GATA-4 binding site (Yamagata et al., 1995
), and a nuclear factor of activated T cells binding site (De Boer et al., 1999
), together with negative regulatory elements that bind the YY1, Oct1, and
an Oct-like nuclear factor (Mordvinov et al., 1999
) or a combination of
YY1 and nuclear factor of activated T cells transcription factors
(Schwenger et al., 1999
). Experiments are now underway to determine the
effect of the test compound on the human IL-5 gene promoter functions
using transfected IL-5 promoter-reporter constructs, electrophoretic
mobility shift assays, and DNase I footprinting.
The in vivo activity of R146225 was first assessed in mice challenged
with the 145-2C11 anti-CD3. When i.v. administered to genetically
susceptible mice, this antibody induces a strong T-cell activation,
evidenced by the appearance in peripheral blood of T-cell-derived
cytokines (documented are IL-2, IL-4, IL-6, IL-10, IFN-
, and tumor
necrosis factor-
) and by the splenic accumulation of cytokine mRNA
(documented are IL-4 and IL-10) (Flamand et al., 1990
; Alegre et al.,
1991
; Durez et al., 1993
; Matthys et al., 1995
). Our data show that
anti-CD3 treatment of Balb/c mice elicited the systemic release of IL-5
and induced the splenic expression of IL-2, IL-4, IL-5, and IFN-
mRNA. R146225 inhibited the in vivo IL-5 protein synthesis with high
oral potency (lowest effective dose 0.16 mg/kg), but its activity was
partial (40-60% inhibition) and evident only at the later times (6 and 8 h) after antibody challenge. The lack of effect at 2 and
4 h may be explained by the anti-CD3-induced release of preformed
IL-5 protein and/or translation of present IL-5 mRNA into releasable
protein. The presence of IL-5 mRNA, albeit at low abundance, in the
spleen of naive mice (Fig. 8, lane 1) may support this explanation. The in vivo effects of R146225 on cytokine synthesis largely resemble its
in vitro activity. At the message level, R146225 abrogated the mRNA
levels of IL-5, but not those of the other cytokines. At the protein
level, the test compound reduced IL-5 production, had little or no
effect on the generation of IL-2 and IL-4, but enhanced IFN-
generation.
According to the Th1/Th2 paradigm (Mosmann and Coffman, 1989
),
activated helper T (Th) lymphocytes are subdivided into at least two
functionally opposing subsets: Th1 cells that secrete IL-2 and IFN-
,
and Th2 cells that produce the "proallergic" IL-4 and IL-5. IFN-
promotes the development of Th1 cells and simultaneously suppresses Th2
cell-driven allergic inflammation. Indeed, administration of
aerosolized IFN-
to allergen-challenged sensitized mice abrogated pulmonary eosinophilia and normalized airway function (Lack et al.,
1996
). Thus, R146225's ability to enhance IFN-
production, together
with its suppression of IL-5 biosynthesis, might synergize to a more
efficient attenuation of Th2 responses. A typical Th2-mediated in vivo
effect is the accumulation of eosinophils in inflamed tissues and, as
such, it is important that R146225 was found to halve the pulmonary
eosinophil recruitment into the lungs of C. neoformans-infected mice. In this microbe-initiated disease model, treatment with anti-IL-5 antibody totally prevented eosinophil recruitment, but also attenuated (by 30-60%) the accumulation of
lymphocytes and macrophages (Huffnagle et al., 1998
). R146225 treatment
did not result in such reduction in mononuclear cells, which may be due
to its incomplete reduction of lung eosinophilia. Remaining eosinophils
may indeed represent a source of chemokines, capable of attracting
lymphocytes and macrophages into the lung. Whether proinflammatory
functions of these lung leukocytes could be affected by the potential
R146225-induced IFN-
formation is being scrutinized. In summary, the
pharmacological activities of R146225 can be characterized as follows:
inhibition of IL-5 protein synthesis and IL-5 mRNA expression,
enhancement of IFN-
protein generation, and ability to reduce
pulmonary eosinophilia in C. neoformans-exposed mice. On the
basis of these data, R146225 may be of potential use in the therapy of
eosinophil-driven disorders.
| |
Acknowledgments |
|---|
We thank G. Verheyen and M. Heylen for skillful assistance in preparing this article.
| |
Footnotes |
|---|
Accepted for publication July 4, 2000.
Received for publication April 19, 2000.
Send reprint requests to: Jean Van Wauwe, Janssen Research Foundation, Turnhoutseweg 30, 2340 Beerse, Belgium. E-mail: jvwauwe{at}janbe.jnj.com
| |
Abbreviations |
|---|
IL, interleukin;
PHA, phytohemagglutinin;
PBMC, peripheral blood mononuclear cell;
CFU, colony-forming unit;
ELISA, enzyme-linked immunosorbent assay;
IFN-
, interferon-
;
PCR, polymerase chain reaction;
Th cell, helper T cell.
| |
References |
|---|
|
|
|---|
receptor-deficient mice are hypersensitive to the anti-CD3-induced cytokine release syndrome and thymocyte apoptosis.
J Immunol
155:
3823-3829[Abstract].
.
Am J Respir Cell Mol Biol
18:
631-642This article has been cited by other articles:
![]() |
Y.-K. Yim, H. Lee, K.-E. Hong, Y.-I. Kim, S.-K. Ko, J.-E. Kim, S.-Y. Lee, and K.-S. Park Anti-inflammatory and Immune-regulatory Effects of Subcutaneous Perillae Fructus Extract Injections on OVA-induced Asthma in Mice Evid. Based Complement. Altern. Med., November 8, 2007; (2007) nem118v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Chen, M. A. Olszewski, R. A. McDonald, J. C. Wells, R. Paine III, G. B. Huffnagle, and G. B. Toews Role of Granulocyte Macrophage Colony-Stimulating Factor in Host Defense Against Pulmonary Cryptococcus neoformans Infection during Murine Allergic Bronchopulmonary Mycosis Am. J. Pathol., March 1, 2007; 170(3): 1028 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Arora, Y. Hernandez, J. R. Erb-Downward, R. A. McDonald, G. B. Toews, and G. B. Huffnagle Role of IFN-{gamma} in Regulating T2 Immunity and the Development of Alternatively Activated Macrophages during Allergic Bronchopulmonary Mycosis J. Immunol., May 15, 2005; 174(10): 6346 - 6356. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hernandez, S. Arora, J. R. Erb-Downward, R. A. McDonald, G. B. Toews, and G. B. Huffnagle Distinct Roles for IL-4 and IL-10 in Regulating T2 Immunity during Allergic Bronchopulmonary Mycosis J. Immunol., January 15, 2005; 174(2): 1027 - 1036. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||