![]() |
|
|
Vol. 289, Issue 2, 632-640, May 1999
Endocrine (X.-L.Z., Y.G., M.D.H.) and
Neuroscience (K.A.S.)
Research Groups,
| |
Abstract |
|---|
|
|
|---|
In rat aorta rings (RA) and in gastric circular muscle (CM) and gastric
longitudinal muscle (LM) preparations maintained in vitro,
inducible nitric oxide synthase (iNOS) induction was monitored functionally (1 mM L-arginine-induced relaxation),
biochemically (appearance of iNOS mRNA), and immunohistochemically.
Functional iNOS (L-arginine-mediated relaxation) was
induced in RA and CM tissues (but NOT in the LM preparation) over 2 to
5 h. iNOS induction was detected by immunocytochemistry in RA
smooth muscle elements and in macrophage-like cells in CM. Functional
iNOS induction correlated with iNOS mRNA induction. In the RA and CM,
functional iNOS induction was blocked by both actinomycin D and
cycloheximide; actinomycin D also blocked the appearance of iNOS mRNA
in both tissues. In contrast, cycloheximide blocked CM (but not RA)
iNOS mRNA induction. In CM tissue, functional iNOS induction was not affected by genistein, tyrphostin 47/AG213, or vanadate. But, in the
RA, both genistein and tyrphostin 47/AG213 blocked the appearance of
functional iNOS; neither inhibitor prevented the appearance of RA iNOS
mRNA. Vanadate, in the RA tissue, blocked both the appearance of iNOS
mRNA and the induction of functional iNOS. In RA tissue, but not in the
CM, inhibitors of NF-
B activation blocked the appearance of
both functional iNOS and iNOS mRNA. We conclude that in different
smooth muscle preparations (aorta versus gastric), there can be a
differential induction of iNOS mRNA and "functional" iNOS not only
in different cellular elements but also in terms of different signaling pathways.
| |
Introduction |
|---|
|
|
|---|
The
induction of nitric oxide synthase (iNOS) in smooth muscle tissue is
believed to account for many of the untoward manifestations of
irreversible shock induced in humans and other mammals by septicemia or
endotoxin (Rees et al., 1990
). Long recognized as an agent responsible
for the bactericidal and tumoricidal actions of macrophages (Green et
al., 1981a
,b
; Hibbs et al., 1987
; Stuehr et al., 1989
), nitric
oxide from macrophages is now known to be synthesized from its
precursor, L-arginine (LR), by an inducible enzyme (iNOS or NOS2) that has been cloned from a number of tissues including rat
smooth muscle cells (Nakayama et al., 1992
; Nunokawa et al., 1993
). It
has been determined that the iNOS induced in macrophages and other cell
types is distinct in amino acid sequence and immunological cross-reactivity from the constitutively produced calcium-regulated enzymes present either in vascular endothelial cells (eNOS or NOS3) or
in neural tissue (nNOS/bNOS or NOS1; Jaffrey and Snyder, 1995
;
Förstermann et al., 1995
). In the past, most of the studies that
have examined the induction of NOS in smooth muscle have used either
cultured cell systems (Busse and Mulsch, 1990
; Nakayama et al., 1992
;
Marczin et al., 1993
) or tissues harvested from animals that had
been pretreated with endotoxin in vivo (Knowles et al., 1990
; Rees et
al., 1990
). More recently, several studies have been conducted using
aorta tissue exposed to lipopolysaccharide (LPS) in vitro (Sirsjö
et al., 1994
; Moritoki et al., 1995
; Duarte et al., 1997
). In our own
work examining the acute actions of growth factors on gastric and
vascular smooth muscle preparations studied using classical organ bath
procedures in vitro (Hollenberg, 1994a
,b
), we became interested in the
possibility that iNOS might be induced in such preparations over the
time course of a routine day's experiment. In exploring this question,
we recently observed that iNOS was indeed induced in rat gastric
circular muscle (CM) strips (but not in the longitudinal muscle) in
vitro. Surprisingly, we found that in the CM tissue, iNOS was located
not in the smooth muscle elements, but rather in a set of
macrophage-related cells that anatomically were in proximity to the CM
cells (Zheng et al., 1997
). Given our own results with the CM tissue
and in view of the above cited information pointing to the induction of
iNOS in the aorta of endotoxin-treated animals and in LPS-treated
arterial smooth muscle cultures and aorta rings, we wished to reexamine in further detail the induction of iNOS in rat aorta rings (RA) maintained in an in vitro organ bath; and for simultaneous comparison, under identical conditions in vitro, the induction of iNOS both in CM
and gastric longitudinal muscle (LM) preparations. Furthermore, we
wished to study, in the distinct RA and CM preparations, possible roles
for tyrosine kinase/tyrosine phosphatase-signaling pathways and for
NF-
B involvement in the induction of iNOS. Because tyrosine kinase
pathways and NF-
B-mediated transcriptional events have been
implicated in iNOS induction, it was our working hypothesis that
inhibitors of tyrosine kinase and NF-
B activation should block iNOS
induction in both the RA and CM preparations. To study these issues, we
examined the induction in vitro of iNOS in the RA and CM preparations
both functionally (using LR-mediated relaxation as an index of iNOS
induction) and biochemically [using the appearance of iNOS mRNA, as
measured by a reverse transcriptase-polymerase chain reaction (RT-PCR)
method]. Furthermore, with an immunohistochemical approach, we
assessed the localization of iNOS induction. The induction of iNOS was
monitored both in the absence and presence of inhibitors of
transcription and translation, as well as in the presence of inhibitors
of tyrosine kinase, tyrosine phosphatase, and NF-
B activation.
| |
Materials and Methods |
|---|
|
|
|---|
Tissue Sources and Bioassay Procedures.
The aorta ring
tissue and the LM and CM preparations were prepared essentially as
described previously (Muramatsu et al., 1988
; Hollenberg et al., 1989
;
Laniyonu and Hollenberg, 1995
). The male Sprague-Dawley rats weighing
approximately 250 g used for our work were cared for according to
the recommendations of the Canadian Council on Animal Care. After
sacrifice by cervical dislocation, the animals were exsanguinated from
the common carotid arteries, and the stomach and aorta tissues were
isolated for further dissection. In brief, RA (2 mm × 3 mm)
either intact or rubbed free of endothelium were mounted at 37°C in a
gassed (95% O2/5% CO2)
Krebs-Henseleit buffer (4 ml) of the following composition (mM): NaCl
(118), KCl (4.7), CaCl2 (2.5),
MgCl2 (1.2), NaHCO3 (25),
KH2PO4 (1.2), and glucose
(10). At hourly intervals, rings were precontracted with 1 µM
phenylephrine, followed by a tissue wash. When appropriate, the
presence of an intact endothelium in the RA preparation was ascertained
by monitoring a relaxation response to 1 µM acetylcholine. The LM and
CM strips (about 3 mm × 10 mm) were prepared from a region of the
fundus that was free from overlying secretory mucosa. The stomach was
opened along the lesser curvature and the smooth muscle element was
carefully dissected free from overlying tissue. The CM and LM strips
were obtained by cutting either along or at right angles to the visible CM bundles, respectively. This procedure allows for the measurement of
contractile responses of either the LM or CM elements derived from the
same tissue preparation (Muramatsu et al., 1988
). As for the RA tissues
(above), the LM and CM preparations were equilibrated at 37°C in
Krebs-Henseleit buffer under a resting tension of about 1 g.
Changes in tissue tension were monitored isometrically using Grass or
Statham force transducers. Routinely, tissue integrity was tested by
monitoring a robust contraction in response to either 50 mM KCl or 1 µM phenylephrine, after which tissues were washed and allowed to
return to baseline tension. Tissues were maintained in the organ bath
with periodic washing (about 45-min intervals) for time periods of up
to 8 h.
Monitoring of iNOS Induction Using the Relaxation Response to
LR.
After mounting the preparations (vascular RA or LM and CM) in
the organ bath, tissues were precontracted with either 1 µM carbachol
(LM preparation) or 1 µM phenylephrine (RA and CM
preparations). At the plateau of the contractile response, LR (1 mM) was added to the organ bath; a relaxant response upon adding LR
served as a pharmacologic index of iNOS induction, as used by us
previously (Zheng et al., 1997
) and by others (Moritoki et al., 1995
).
Tissues were then washed three times to remove agonist and excess LR
from the organ bath. The LR-induced relaxation response has been found to provide an accurate reflection of the induction of functional iNOS
(Moritoki et al., 1995
; Zheng et al., 1997
). The time course of the
induction of iNOS was determined pharmacologically by monitoring LR-induced relaxation every hour during the incubation of tissue in the
organ bath; tissues were washed at 45-min intervals. When present,
actinomycin D (ACTD) or cycloheximide (CHX; both obtained from Sigma,
St. Louis, MO) were present from the beginning of an experiment. The
effects of tyrphostin 47 (AG213; Calbiochem, La Jolla, CA), vanadate
(VAN; Sigma), tosyl-phenylalanyl-chloromethyl ketone (TPCK, Sigma), and
pyrrolidinedithiocarbamate (PDTC; Sigma) were also assessed by adding
these reagents at the start of a prolonged incubation period (5 h).
After 5 h, the tissue was washed free from these reagents
immediately before the assessment of iNOS induction by pharmacological
(i.e., LR-induced relaxation), biochemical (RT/PCR evaluation of mRNA
presence), or immunohistochemical procedures. The enzyme inhibitors
aminoguanidine (AG; Sigma) and LY83583 (Sigma) were added to the organ
bath before the evaluation of tissue responsiveness (see Fig.
1).
|
Preparation of Tissue RNA and RT-PCR Analysis.
Total tissue
RNA from the CM and RA preparations was extracted with the
TRI-reagent protocol (Molecular Research Center, Cincinnati, OH)
both before and after prolonged incubation of tissue samples in the
organ bath. The RNA was reverse-transcribed with a first strand cDNA
synthesis kit using pd(N)6 primer (Pharmacia LKB Biotechnology, Uppsala, Sweden) according to manufacturer's recommendations at 37°C
for 1.5 h; 3 µl of this solution was used to amplify the iNOS
cDNA fragment. The sequences of the forward (5'CCAGGGGCAAG CCATGTC3')
and reverse (5'CTCCAGGCCATCTTGGTGGC3') primers were based on the
published rat aorta smooth muscle iNOS cDNA sequence (Nunokawa et al.,
1993
). Sequencing of cDNA subcloned into the pBluescript SK- phagemid
was done using the dideoxynucleotide sequencing method (Sanger et al.,
1977
) and a T7 DNA polymerase sequencing kit (Pharmacia). The RT-PCR signals obtained from the gastric and aorta tissue were
normalized to the PCR signal generated concurrently by an actin primer
pair (Watson et al., 1992
) that spans an intron: forward primer
(5'CGTGGGCCGCCCTAGGCACCA3'; reverse primer (5'TTGGCCT TAGGGTTCAGGGGG3'). The detection of a 243-bp PCR product using this
primer pair can confirm the absence of intron sequences in the RT
product obtained from tissue RNA.
Immunohistochemistry.
Both before and after a 5-h incubation
in the organ bath, tissues were fixed at 4°C by overnight immersion
in 4% paraformaldehyde in 0.1 M PBS (pH 7.4). Fixed tissue was then
washed with PBS (3 × 10 min) and cryoprotected by immersion in
PBS containing 20% (w/v) sucrose. Tissues were sectioned (12 µm) in
a cryostat and then processed for indirect immunofluorescence. Sections
were washed with PBS containing 0.1% Triton X-100 for 30 min at room temperature and incubated with the primary antibodies for 24 to 48 h at 4°C in a moist chamber. The primary anti-iNOS antibody used
(1:500 dilution) was purchased from Transduction Laboratories (Lexington, KY). The mouse anti-rat macrophage antibody (clone ED2,
1:1500 dilution) was purchased from Serotec (Oxford, UK; Dijkstra et
al., 1985
). After exposure to the primary antibody, sections were
rinsed (3 × 10 min) in PBS and then incubated for 1 h at
room temperature with secondary antibodies (donkey anti-rabbit IgG
conjugated to cyanine 3 at a dilution of 1:100, Jackson Immuno Research Laboratories, West Grove, PA and/or goat anti-mouse IgG conjugated to fluorescein isothiocyanate (FITC), 1:50, Incstar, Stillwater, MN). Finally, sections were washed with PBS containing 0.1% triton X-100 (3 × 10 min) and mounted in
bicarbonate-buffered glycerol (pH 8.6). Sections were examined using a
Ziess Axioplan fluorescence microscope and photographs were taken with
Kodak TMax 400 ASA film. Nonspecific immunoreactivity was assessed
using both "noninduced" tissues as controls and nonspecific primary antisera in both control and "induced" tissues.
Monitoring NF-
B Activation Using an
Immunoprecipitation/Western Blot Approach.
RA tissue was
isolated and mounted in the oxygenated organ both exactly as for the
bioassay procedure (above) either in the absence or presence of 20 µM
TPCK. After 3 h at 37°C, tissues were harvested (four to five
rings pooled for each condition), quick-frozen on solid
CO2, and stored at
70°C for further analysis. Nonincubated tissue samples served as a control. The frozen tissue (about 800 mg/pooled tissue sample) was rapidly thawed, diced, and
homogenized (Polytron, Brinkman Instruments, Rexdale, Ontario, Canada) in 2 ml of an immunoprecipitation buffer comprising 50 mM Tris HCl, pH 7.4 supplemented with 1% v/v detergent Nonidet P40, 0.25% (w/v) sodium deoxycholate, 1 mM EDTA, 1 mM
phenylmethyl sulfonyl fluoride, 1 mM sodium VAN, 1 mM NaF, 1 µg/ml
each of aprotinin and leupeptin, and 150 mM NaCl. Tissue extracts were clarified by centrifugation (13,000 RPM for 20 min at 4°C in a 2-ml
microfuge tube), and protein concentrations were measured using the
BioRad reagent (BioRad, Richmond, CA).
Immunoprecipitation and Immunoblot Detection of NF-
B.
Equal protein aliquots of tissue extract (100 µg) were added to 1 ml
of a saline (300 mM NaCl)- fortified 50 mM sodium phosphate buffer, pH
8.0 (PBS) and were incubated for 1 h at 4°C with 0.5 µg/ml of
a monoclonal antibody targeted to the nuclear localization sequence of
the p65 subunit of NF-
B (catalog no. 1697838; Boehringer Mannheim,
Laval, Quebec). This concentration of antibody does not displace
NF-
B from the NF-
B inhibitory subunit, I-kB and recognizes
only the active NF-
B subunits free from IkB (Kaltschmidt et al.,
1995
). The immune complex containing activated NF-
B was then
harvested by the addition of protein G-sepharose beads (100 µl of a
50% v/v suspension in isotonic phosphate buffer, pH 7.4; Sigma) and
incubated at 4°C overnight. Bead-bound protein was washed five times
by centrifugation (microfuge) with 100 µl of the above described PBS,
pH 8.0. Protein adsorbed to the washed beads was eluted at 100°C into
30 µl of SDS/mercaptoethanol containing electrophoresis sample buffer
(Laemmli, 1970
) and 25 µl of the eluted sample was subjected to
electrophoresis in SDS containing 11% polyacrylamide gels (1 mm × 6 cm × 8 cm) for 1.5 h at 100V at room temperature. After
electrophoresis, protein was transferred (30V overnight at 4°C) to
nitrocellulose membranes (0.45 µm; BioRad) before immunoblot
detection. Membranes were blocked with 10% (w/v) BSA for 1 h at
room temperature, followed by exposure for 1 h at room temperature
to a 1:500 dilution (final concentration 2 µg/ml) of the murine
monoclonal antibody described above, targeted to the nuclear
localization sequence of the NF-
B p65 subunit. After washing in 10 mM Tris/saline pH 7.4, the blot was exposed to the second antibody
(1/50,000 dilution of supplied reagent of goat anti-mouse IgG, coupled
to horseradish peroxidase; Amersham, Oakville, ON) and the location of
NF-
B was visualized by chemiluminescence detection (Amersham ECL
reagent, Amersham).
| |
Results |
|---|
|
|
|---|
Pharmacologic Indices of iNOS Induction and Detection of iNOS
mRNA.
To evaluate iNOS induction in the intact tissue strips, we
anticipated that under the conditions of the organ bath, tissue stores
of LR might not be sufficient to cause a spontaneous relaxation of the
tissue when iNOS was induced. In view of this supposition, it was
expected that in contrast with freshly isolated tissue, the addition of
1 mM LR to a precontracted tissue in which iNOS had been
induced would cause relaxation due to the metabolism of LR to
NO. In keeping with this supposition, the addition of LR to freshly
isolated vascular and gastric tissues caused no relaxation effect
(left, tracings A to D, Fig. 1) in tissues that otherwise relaxed in
response to 10 nM sodium nitroprusside (SNP; *, Fig. 1). In contrast,
after incubation of the tissues in the organ bath for a period of
5 h, the addition of 1 mM LR to precontracted tissues
caused a prompt relaxation of either the RA (middle tracings A and B,
Fig. 1) or CM (middle tracings C and D) preparations, as has been
observed previously by others for RA preparations (Moritoki et al.,
1995
). The induction of iNOS we observed was spontaneous, reproducible
over a series of experiments conducted over a 12- to 16-month time
period, and did not require the addition of LPS to the organ bath. To
rule out any influence of eNOS, we used endothelium-free RA
preparations (lack of relaxant response to 1 µM acetylcholine;
left-hand portion of tracings A and B, Fig. 1). Comparable results were
obtained with endothelium-intact preparations (not shown). As with our
previous observations (Zheng et al., 1997
), no relaxation was observed
upon adding LR to a LM preparation that had been maintained for 5 h in the organ bath (not shown). Thus, the LM tissue was not studied
further. In both the RA and CM preparations, the iNOS inhibitor, AG
(
, Fig. 1, A and C), blocked the LR-induced relaxation
that had appeared after the 5-h incubation period (right-hand portions
of tracings A and C, Fig. 1) but both tissues were still responsive to
SNP (right-hand portions of tracings A and C, Fig. 1). In contrast, in
induced RA and CM tissues, the guanylyl cyclase inhibitor, LY83583,
(
, tracings B and D, Fig.1) not only blocked LR-induced relaxation
but also inhibited relaxation caused by SNP (right-hand portion of
tracings B and D, Fig. 1). In both the RA and CM tissues, the ability
of LR to cause a relaxant response became apparent after 2- to 3-h
incubation in the organ bath and was maximal at about 4 to 6 h
(Fig. 2). The addition of LPS (5 µg/ml)
to the organ bath did not alter the time course or extent of iNOS
induction in either RA or CM preparations (not shown). In keeping with
our previous observations with CM tissue (Zheng et al., 1997
), the appearance of LR-induced relaxation of the RA tissue coincided with the
appearance of a prominent RT-PCR signal generated by the iNOS-targeted
primer pairs (Fig. 3). Sequencing of the
PCR product, which was maximal at 5 h, verified that it did indeed represent iNOS (not shown).
|
|
Immunohistochemical Localization of iNOS.
In fresh tissue,
iNOS was not visualized either in the RA or CM preparations (Fig.
4, A and C). Only background staining, which was equivalent to that observed using nonimmune serum, was detected (not shown). Nonetheless, in the RA tissue, after
5 h in the organ bath (a time corresponding to a maximal
relaxation response caused by LR), a prominent iNOS immunoreactivity
was detected in the smooth muscle layer (Fig. 4, B). In contrast, in
the CM preparation, the iNOS immunoreactivity was localized primarily
in a subset of cells found in the submucosal layer (Fig. 4, D, small
arrows) rather than in the smooth muscle elements. Double staining of
the induced CM preparations with the iNOS and macrophage-specific
antibodies revealed a coincidence of immunoreactivity for the cells
localized in the submucosal layer of the CM preparation (data not
shown; Zheng et al., 1997
).
|
Effects of Inhibitors on Induction of Functional iNOS.
We
evaluated the effects of a variety of inhibitors on the appearance of
functional iNOS in the RA and CM preparations, as assessed by the
ability of LR to cause a relaxation in a precontracted tissue that had
previously been maintained in the organ bath for 5 h (Fig.
5). For experiments with each inhibitor,
sets of control and inhibitor-treated tissues were run in parallel;
Fig. 5 shows a representative control tissue along with representative
tracings for experiments done with each inhibitor. In the RA tissue,
the transcriptional and translational inhibitors, ACTD and CHX, both blocked the appearance of functional iNOS (Fig. 5, B and C). In the CM
preparation, the transcriptional and translational inhibitors also
abrogated the appearance of functional iNOS (Fig. 5, H and I).
Unexpectedly, in the RA preparation, inhibitors of both tyrosine kinase
(AG213) and tyrosine phosphatase (VAN) appeared equally effective in blocking the appearance of functional iNOS (Fig. 5, D and
E). In contrast, in the CM preparation, neither AG213 nor VAN affected
the appearance of functional iNOS (Fig. 5, J and K). Both TPCK (Fig. 5,
F) and PDTC (not shown), known for their ability to block NF-
B
activation via presumably different mechanisms, blocked the appearance
of functional iNOS in the RA preparation. Again, in contrast with the
RA tissue, neither of the two inhibitors of NF-
B activation blocked
the appearance of functional iNOS in the CM preparation, as assessed by
LR-induced relaxation (Fig. 5, L; data not shown). In the
RA preparation, the appearance of functional iNOS correlated with an
increase in the amount of active NF-
B, as detected by an
immunoprecipitation/Western blot procedure using an antibody targeted
to active NF-
B (Kaltschmidt et al., 1995
; Fig
6, middle lane). The increase in the
abundance of activated NF-
B was blocked in the presence of TPCK, in
keeping with the ability of TPCK to block the appearance of functional iNOS.
|
|
Effects of Inhibitors on the Appearance of iNOS mRNA.
In each
instance wherein an inhibitor blocked the appearance of functional iNOS
(LR-induced relaxation), we wished to determine if the appearance of
iNOS mRNA, as assessed by RT-PCR, was similarly affected. All PCR
signals for iNOS were compared relative to the actin PCR signal
obtained from the identical RT product. In all cases, the 243-bp actin
PCR product indicated that the RNA used for the procedure had been free
from genomic DNA. In both the RA and CM tissue, as anticipated for an
induced protein, the transcriptional inhibitor, ACTD blocked the
appearance of iNOS mRNA (Fig. 7, top). Similarly, in the RA tissue, as expected, the translational inhibitor CHX had no effect on the appearance of iNOS mRNA (Fig. 7, upper left).
In contrast with the results using RA tissue, in the CM tissue the
presence of CHX, like ACTD, markedly attenuated (by about 90%, based
on densitometry of the PCR bands, relative to actin) the appearance of
iNOS mRNA (Fig. 7, upper right). We next turned our attention to the RA
tissue that had been treated with either of the tyrosine kinase
inhibitors, genistein (GS) or AG213. Although both of these
tyrosine kinase inhibitors blocked the induction of functional iNOS
(Fig. 5, tracing D and data not shown), neither GS nor AG213/TP47
blocked the appearance of iNOS mRNA (Fig.
8, A). In contrast, VAN, which blocked
the induction of functional iNOS in the RA preparation (Fig. 5, E) also
blocked the appearance of iNOS mRNA in the tissue (Fig.
9). In keeping with the ability of the
inhibitor of NF-
B activation, TPCK, to block the induction of
functional iNOS in the RA preparation and to attenuate the increase of
active NF-
B visualized by Western blot analysis (Fig. 6), TPCK also
markedly attenuated the appearance of RA iNOS mRNA (Fig.
10). Comparable effects were observed
with PDTC (not shown). In contrast with the results with the RA tissue, neither the tyrosine kinase/tyrosine phosphatase inhibitors nor the
inhibitors of NF-
B activation affected the appearance of iNOS mRNA
in the CM tissue, in keeping with the lack of effect of these agents on
the appearance of functional iNOS (Fig. 5, J to L, and data not shown).
The effects of the various inhibitors on the appearance of functional
iNOS and on the appearance of iNOS mRNA are summarized in Table
1.
|
|
|
|
|
| |
Discussion |
|---|
|
|
|---|
Our results both confirm and in many ways extend our preliminary
study of the induction of iNOS in CM preparations (Zheng et al.,
1997
), particularly in terms of the differences in the signal
transduction pathways governing iNOS induction in gastric versus aorta
smooth muscle. Furthermore, in contrast with previous studies with
intact aorta (Moritoki et al., 1995
; Duarte et al., 1997
), we were able
to assess independently the differential effects of the inhibitors we
used both on the induction of iNOS mRNA and on the induction of
functional iNOS. The main finding of our new work was that in smooth
muscle tissue taken from different anatomic locations, there was a
marked difference in the cellular sites of iNOS induction. In the aorta
preparation, iNOS induction was localized predominantly within the
smooth muscle elements whereas in the CM preparation, iNOS was not
detected in the smooth muscle, but was prominently expressed in a set
of submucosal macrophage-related cells. In each tissue preparation,
nonetheless, the induction of functional iNOS, as monitored by the
ability of LR to cause an AG and LY83583-inhibitable relaxation, was
closely correlated with the appearance of iNOS mRNA, and in both the
gastric and vascular smooth muscle preparations, iNOS induction could
be seen to have an effect on tissue contractility. This inhibitory
effect would be expected to have a direct impact on the regulation of vascular and gastric smooth muscle function in vivo
It was surprising to us that the same experimental conditions and
presumably the same stimuli in the identical organ bath that led to a
robust induction of iNOS in the vascular smooth elements did not result
in a comparable induction in the smooth muscle cells of the CM
preparation as detected immunohistochemically. Differences in the
induction of iNOS mRNA by LPS and interferon-
have previously been
observed in smooth muscle cells depending on whether the cells were in
intact strips or propagated in tissue culture (Sirsjö et al.,
1994
). Furthermore, a variety of different stimuli have been observed
to modulate iNOS induction, even in the same cultured cell type
(Gilbert and Herschman, 1993a
,b
; Förstermann et al., 1995
).
However, differences in vivo between tissues with the same phenotype
(i.e., smooth muscle) have yet to be reported using an
immunohistochemical approach. Although it was not possible to determine
the precise stimulus in the organ bath that led to iNOS induction
(e.g., the trauma of tissue dissection, or very possibly, the presence
of endotoxin in the organ bath), our data point to interesting
differences in the iNOS induction pathway between vascular and gastric
tissue. Simply adding LPS to the organ bath failed to alter the time
course or extent of iNOS induction in the RA tissue. Furthermore, our
work failed to identify an agent that, upon addition to the organ bath,
led to an induction of iNOS in the gastric smooth muscle elements. Two
possibilities that might account for the differences in iNOS induction
between the two tissues may relate to differences in the coinduction of the LR transporter and differences in the profile of cytokines produced
by the two tissues as a result of the dissection procedure. Because the
coinduction of the LR transporter may be a prerequisite for
observing a functional iNOS response (Simmons et al., 1996a
,b
), it
would be of value in future studies to assess the induction of this
transporter in the RA and CM preparations. Furthermore, it would be of
interest to treat both the RA and CM preparations with a "cytokine
cocktail" to determine if iNOS induction can be accelerated (RA) or
triggered (CM) in the smooth muscle cells. To our knowledge, the
induction of iNOS in gastric smooth muscle elements has yet to be
reported. Thus, further work is warranted to examine the inducibility
(or lack thereof) of iNOS in gastric smooth muscle and to identify the
precise stimulus responsible for the spontaneous induction of iNOS in
the RA tissue (usually presumed to be contamination with endotoxin).
It was of interest that the various inhibitors we used resulted in
differential effects on the induction of iNOS in the RA tissue compared
with the CM preparation (summarized in Fig. 5 and Table 1). These
differences most likely reflect the distinct cell types within the two
tissues where iNOS was maximally induced (i.e., the smooth muscle cells
in the RA tissue versus the macrophage-related cells in the CM tissue).
One interesting difference that we observed was that CHX inhibited the
induction of iNOS mRNA in the CM but not in the RA tissue (Fig. 7).
These data suggest that the new synthesis of protein paracrine factors
may play different roles in the induction of iNOS in the RA and CM
tissue. Although rapidly synthesized paracrine or intracellular factors
(e.g., the transcription factor AP1) that can up-regulate iNOS
transcription very likely play an important role in the modulation of
iNOS in the macrophage-related cells present in the CM tissue, other
mechanisms may govern iNOS induction in vascular smooth muscle. Results
that reflect our observations with the CM tissue have been reported for
iNOS induction in murine and rat macrophages (Chesrown et al., 1994
)
and in insulin-producing HIT cells (Eizirik et al., 1993
). The lack of
effect of the tyrosine kinase/phosphatase inhibitors and of the
inhibitors of NF-
B activation on iNOS induction in the CM tissue as
opposed to the RA tissue (Figs. 5 and 8 and Table 1) highlight further
the marked differences between the signaling pathways that regulate
iNOS induction in the two tissue types.
One of our working hypotheses was that the induction of iNOS in the RA
and CM tissues might involve the activation of a tyrosine kinase
signaling pathway. Thus, we anticipated that tyrosine kinase inhibitors
might block, and that a tyrosine phosphatase inhibitor might
potentiate, the induction of iNOS. This hypothesis was in keeping with
our previous studies of the role of tyrosine kinase/phosphatase pathways in regulating contractility (Laniyonu et al., 1994a
; Hollenberg, 1994b
). The hypothesis would also be in keeping with the
ability of tyrosine kinase inhibitors to abrogate LPS-induced lethal
toxicity (Novogrodsky et al., 1994
), to attenuate LPS-induced induction
of iNOS in murine macrophages (Dong et al., 1993
), and to abrogate
circulatory failure (Ruetten and Thiemermann, 1997
). It was,
therefore, not expected that both AG213 and VAN would block the
induction of functional iNOS in the RA tissue (Fig. 5) and that neither
reagent would affect iNOS induction in the CM tissue. The effects of GS
agreed with the observations of Moritoki et al. (1995)
who found that
tyrosine kinase inhibitors blocked functional iNOS induction in RA, but
who did not monitor iNOS mRNA. Our data also agreed with a study that
appeared after the completion of our work (Duarte et al., 1997
),
showing that both GS and VAN blocked the appearance of functional iNOS
in endotoxin-treated RA. Nonetheless, our work considerably extends the
previous observations by demonstrating an effect of VAN at the level of
mRNA induction and an effect of AG213 at an as yet unidentified
post-transcriptional level. Furthermore, our work localizes the iNOS in
the RA tissue specifically in the smooth muscle elements. The results
with the CM tissue would suggest that in contrast with the RA tissue,
tyrosine kinase and tyrosine phosphatase signal pathways may both be
irrelevant for the induction of iNOS in certain tissues (e.g., the
macrophage-related cells in the CM preparation). Conversely, in the RA
preparation, tyrosine kinase and tyrosine phosphatase signal pathways
would appear to act in concert for the induction of iNOS. The data
obtained with VAN in the RA tissue (Figs. 5 and 9 and Table 1) indicate that an increase in cellular tyrosine phosphorylation (see Fig. 6 of
Laniyonu et al., 1994b
) leads to a suppression of iNOS transcription; yet, the AG213-mediated inhibition of ambient tyrosine kinase activity
in the setting of iNOS induction did not affect the transcription of
iNOS mRNA (Fig. 8, A; Table 1). Nonetheless, both tyrosine kinase
inhibitors that we used blocked the induction of functional iNOS. Thus,
as alluded to above, our data point to a role for multiple tyrosine
kinase steps involved at both the transcriptional (blocked by VAN) and
the translational/post-translational (blocked by GS/AG213) levels for
iNOS induction.
A final issue raised by our results relates to the potential role for
NF-
B activation. The differential inhibition of iNOS induction in
the RA versus the CM tissue by TPCK and PDTC would suggest that in
selected tissues, such as the macrophage-related cells in the gastric
tissue, transcription factors other than NF-
B may be involved in
iNOS induction. This suggestion would be in contrast with the data
linking PDTC-sensitive NF-
B activation to iNOS induction (Xie et
al., 1994
; Nunokawa et al., 1996
). The mechanisms that underlie the
differential induction of iNOS in different smooth muscle preparations
via apparently distinct signaling pathways remain an intriguing topic
for further study.
| |
Acknowledgments |
|---|
K.A. Sharkey is an Alberta Heritage Foundation for Medical Research Senior Scholar. We thank Dr. C.R. Triggle for helpful discussions, Dr. S. Ahmad for help with the cloning of iNOS, and Winnie Ho for assistance with the immunohistochemical studies.
| |
Footnotes |
|---|
Accepted for publication November 25, 1998.
Received for publication May 28, 1998.
1 These studies were supported primarily by a grant from the Alberta Heart and Stroke Foundation (M.D.H.), with ancillary support from the Medical Research Council of Canada (M.D.H. and K.A.S.). X.-L.Z. was supported in part by a William H. Davies Research Scholarship and a Graduate Studentship from the Canadian Hypertension Society in conjunction with Pfizer and the Canadian Medical Research Council.
Send reprint requests to: Dr. Morley D. Hollenberg, Departments of Pharmacology & Therapeutics and Medicine, The University of Calgary, Faculty of Medicine, 3330 Hospital Drive, Calgary, AB Canada T2N 4N1. E-mail: mhollenb{at}acs.ucalgary.ca
| |
Abbreviations |
|---|
ACTD, actinomycin D;
AG, aminoguanidine;
AG213, tyrphostin 47;
CHX, cycloheximide;
CM, gastric
circular muscle;
GS, genistein;
I-
B, NF-
B inhibitory subunit;
iNOS, inducible nitric oxide synthase (NOS2);
LM, gastric longitudinal
muscle;
LR, L-arginine;
PDTC, pyrrolidinedithiocarbamate;
RA, rat aorta rings;
RT-PCR, reverse transcriptase-polymerase chain
reaction;
TPCK, tosyl-phenylalanyl-chloromethyl ketone;
VAN, vanadate;
LPS, lipopolysaccharide;
SNP, sodium nitroprusside.
| |
References |
|---|
|
|
|---|
-induced NO synthesis in aortic smooth muscle cells.
Am J Physiol
265:
H1014-H1018This article has been cited by other articles:
![]() |
J. Blanchette, P. Pouliot, and M. Olivier Role of protein tyrosine phosphatases in the regulation of interferon-{gamma}-induced macrophage nitric oxide generation: implication of ERK pathway and AP-1 activation J. Leukoc. Biol., March 1, 2007; 81(3): 835 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Forget, D. J. Gregory, L. A. Whitcombe, and M. Olivier Role of Host Protein Tyrosine Phosphatase SHP-1 in Leishmania donovani-Induced Inhibition of Nitric Oxide Production. Infect. Immun., November 1, 2006; 74(11): 6272 - 6279. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Koetzler, M. Saifeddine, Z. Yu, F.S. Schurch, M. D. Hollenberg, and F. H. Y. Green Surfactant as an Airway Smooth Muscle Relaxant Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 609 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Foti, R. Iuliano, E. Chiefari, and A. Brunetti A Nucleoprotein Complex Containing Sp1, C/EBP{beta}, and HMGI-Y Controls Human Insulin Receptor Gene Transcription Mol. Cell. Biol., April 15, 2003; 23(8): 2720 - 2732. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gui, X.-L. Zheng, and M. D. Hollenberg Interleukin-1beta , Src- and non-Src tyrosine kinases, and nitric oxide synthase induction in rat aorta in vitro Am J Physiol Heart Circ Physiol, August 1, 2000; 279(2): H566 - H576. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-L. Zheng, S. Matsubara, C. Diao, M. D. Hollenberg, and N. C. W. Wong Activation of Apolipoprotein AI Gene Expression by Protein Kinase A and Kinase C through Transcription Factor, Sp1 J. Biol. Chem., October 6, 2000; 275(41): 31747 - 31754. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-L. Zheng, S. Matsubara, C. Diao, M. D. Hollenberg, and N. C. W. Wong Epidermal Growth Factor Induction of Apolipoprotein A-I Is Mediated by the Ras-MAP Kinase Cascade and Sp1 J. Biol. Chem., April 20, 2001; 276(17): 13822 - 13829. [Abstract] [Full Text] [PDF] |
||||
| |||||||||