Introduction

Top Abstract Introduction Materials & Methods Results Discussion References

NAALADase and its neuropeptide substrate NAAG have been implicated in the regulation of excitatory signaling in the nervous system, and alterations in levels of NAALADase and NAAG have been observed in disorders that are thought to involve abnormalities in glutamatergic neurotransmission (Tsai et al., 1991, 1995; Meyerhoff et al., 1992). NAALADase activity and protein have also been detected in non-neural tissues, including the kidney and sexual organs (Slusher et al., 1990). NAALADase (EC 3.4.17.21) possesses glutamate carboxypeptidase activity in vitro against NAAG, -aspartylglutamate, -glutamylglutamate, -glutamylglutamate, and methotrexate poly--glutamates (Robinson et al., 1987; Serval et al., 1990; Slusher et al., 1990; Pinto et al., 1996). In vivo hydrolysis of NAAG by NAALADase in brain has also been demonstrated (Stauch et al., 1989; Serval et al., 1992).

The molecular characterization of the enzyme or enzymes responsible for NAALADase activity has been of considerable interest. The cDNA for one form of human NAALADase, also known as PSMA (Israeli et al., 1993), has been isolated from human prostatic tumor cells (Carter et al., 1996). The precise molecular relationship between PSMA and the human brain enzyme, however, has remained unclear. The PSMA antigen was identified originally as the ligand of the monoclonal antibody 7E11-C5, whose histological profile of immunoreactivity demonstrated a high degree of selectivity for prostatic tissue (Horoszewicz et al., 1987). Thus, PSMA has been proposed as a prostate cancer marker antigen and, accordingly, is being examined for possible use in the diagnosis of prostatic malignancies and detection and treatment of metastatic prostatic disease. Indium 111 and yttrium 90 radioimmunoconjugate derivatives of the monoclonal antibody 7E11-C5 (CYT-356) are currently in clinical trials for radiologic imaging and irradication of prostate-derived tumor cells, respectively (Kahn et al., 1994; Deb et al., 1996). In addition, clinical trials of PSMA-targeted dendritic cell immunotherapies are under way (Tjoa et al., 1997). The diagnostic and prognostic values of PSMA-based immunoassay and RT-PCR assay also are under evaluation (Heston, 1995; Murphy et al., 1996).

Studies assessing the presence of PSMA-like species in the brain have yielded varying results. The absence of PSMA-like immunoreactivity in human brain sections has been reported in two studies (Horoszewicz et al., 1987; Silver et al., 1997). In contrast, the presence of PSMA-like RNAs in brain has been detected by Northern analysis (Carter et al., 1996), RNase protection assay (Israeli et al., 1994) and RT-PCR (Uría et al., 1997). The molecular characterization of the human brain NAALADase enzyme is important for two distinct reasons. First, establishing the molecular identity of human brain NAALADase is paramount to the exploration of its relationship to glutamatergic neurotransmission. Second, knowledge of the extent of similarity between the brain and prostate forms of the enzyme would be important in addressing the possible neurological ramifications of using PSMA-targeted imaging and cytotoxic agents.

Because the importance of its molecular description had become clear, we designed a strategy to characterize human brain NAALADase. Based on the results of previous RNA analyses, we hypothesized that PSMA and brain NAALADase would possess molecular similarities. Thus, we characterized the NAALADase expressed in human cerebellum using molecular probes directed against PSMA. This has resulted in the detection of a PSMA-like NAALADase protein and the isolation of a human brain cDNA, which confirm that PSMA is indeed expressed in the human nervous system.

	Materials and Methods

Top Abstract Introduction Materials & Methods Results Discussion References

Chemicals. General chemical reagents were obtained from Fisher Scientific (Pittsburgh, PA) or Sigma Chemical (St. Louis, MO). Dr. Barbara Slusher (Guilford Pharmaceuticals, Baltimore, MD) kindly provided the NAALADase inhibitor PMPA (Jackson et al., 1996).

Cell lines and culture medium. The LNCaP and PC3 tumor cell lines were obtained from the American Type Culture Collection (Rockville, MD). LNCaP cells were grown in RPMI 1640 supplemented with 2 mM glutamine, nonessential amino acids, penicillin/streptomycin (50 units/50 µg/ml) and 5% fetal bovine serum. PC3 cells were cultured in minimum essential medium supplemented with penicillin/streptomycin and 10% fetal bovine serum. All medium reagents were obtained from GIBCO BRL (Bethesda, MD).

Human brain tissue. Control human brain tissue (case numbers 3262 and 3547) was obtained from the McLean Hospital Brain Tissue Resource Center (Belmont, MA). Brain membranes were prepared for immunoprecipitation studies and NAALADase assays as described previously (Tsai et al., 1995). Protein concentration of the solubilized samples was determined by BCA assay using the enhanced protocol with bovine serum albumin as standard (Pierce, Rockford, IL).

RNA. Total RNA from the LNCaP cell line was prepared according to the method of Chirgwin et al. (1979), and human brain poly(A)⁺ RNA was obtained from Clonetech (Palo Alto, CA).

Northern blotting. RNA was resolved by electrophoresis through a 1.2% agarose gel containing 3% formaldehyde, electrophoretically transferred to a nylon membrane and hybridized to a random-primed³²P-radiolabeled cDNA probe (S.A. = 6.0 × 10⁹ dpm/µg) prepared using a Prime-It kit (Stratagene, La Jolla, CA) at 42°C overnight. Final high-stringency washes were performed with 0.1× SSC plus 0.1% SDS at 65°C. Hybridization was detected by autoradiography using a Molecular Dynamics PhosphorImager (Sunnyvale, CA).

Enzyme assays. Radioenzymatic assays, which measured the release of [³H]glutamate from N-acetylaspartyl-[³H]glutamate, were conducted in triplicate as described by Tsai et al. (1995) and included protein-free blanks as negative controls. N-Acetylaspartyl-[³H]glutamate was purchased from DuPont-New England Nuclear (Boston, MA). NAAG hydrolysis was allowed to proceed for a duration of 2 hr to maximize signal. This did not affect the linearity of the assay; no more than 20% of the substrate was consumed during this period. Assays comparing human brain and cloned enzyme samples were normalized for NAALADase content by enzyme activity [V_max of NAAG hydrolysis = 175 ± 25 fmol/min as determined by preliminary experiments]; total protein in the assay samples was 2.5 µg (PSMA2), 15 µg (3242) or 25 µg (3547)). Results shown are the mean ± S.E.M. activities of triplicate assays. Curve fit was determined by a nonlinear least-squares minimization algorithm.

Immunoprecipitation experiments. After initial titration experiments to determine optimal precipitation, 30 µg of purified 7E11-C5 monoclonal antibody (a gift of Drs. Gerald Murphy and Alton Boynton, Northwest Hospital, Seattle, WA) was incubated with 100 mg of Protein A/trisacryl (Pierce) at 4°C overnight in 300 µl of 25 mM Tris·Cl, 0.9% NaCl and 0.25% Triton X-100, pH 7.0 (TTS). The Protein A-resin/immunoglobulin complexes were then precipitated by centrifugation (400 × g for 2 min). Subsequently, the supernatants were removed, and the pellets were washed three times with 1 ml of TTS. The resultant pellets were then incubated overnight at 4°C with 12.5 µg of Triton X-100-solubilized human brain membranes that had been previously centrifuged for 5 min at 400 × g to remove insoluble material. Pellets were separated from the supernatant fraction of the sample (100 µl) by centrifugation at 400 × g for 2 min, and the supernatants were saved for enzymatic assay. The pellets were then washed twice with 100 µl of TTS, and these washes were saved and assayed. Final pellet fractions were resuspended in 100 µl of TTS and assayed in parallel. A series of control samples, which contained the brain membranes and Protein A/trisacryl, but no antibody, distinguished specific immunoprecipitation from nonspecific binding. NAAG hydrolysis by the first supernatant and two wash fractions were added together and considered the total supernatant activity. Negative and positive control samples included 100 µl of the immunoprecipitation buffer (TTS).

RT-PCR cloning of brain cDNAs. RT reactions were conducted at 47° to 50°C for 2 hr using Superscript II reverse transcriptase (BRL) according to the manufacturer's recommended conditions with the addition of 40 units/25 µl of recombinant RNasin (Promega, Madison, WI) and 3.33 mM dimethylsulfoxide in the RNA denaturation step (equivalent to 2 mM final concentration in the transcription reaction) and a PSMA-derived oligonucleotide primer of the sequence: TTTATATATAATATTCAAC. The reverse transcriptase then was heat-inactivated by incubation at 70°C for 15 min, and RNA-cDNA hybrids were treated with RNase H (Promega) for 10 min at 55°C. Single-stranded cDNA was isolated with PCR Purification Cartridges (Advanced Genetic Technologies, Gaithersburg, MD) before use in the subsequent PCR amplification. Primers used for the amplification of the 5' segment of the cDNA were of the sequences TGCAGGGCTGATAAGCGAG and CCTCTGAGAGTACCTATCACA. The amplification of the 3' segment of the cDNA was performed with primers of the sequences TCATCCAATTGGATACTATG and TCTTTCTGAGTGACATAC. Thermal cycling parameters consisted of: denaturation at 94°C for 5 min (initial) or 1 min (subsequent); annealing at 60°C (5' cDNA) or 50°C (3' cDNA) for 1 min; and extension at 72°C for 3 min. Each round of amplification was comprised of 35 cycles. DNA sequence analysis was performed by the dideoxy method using the Pfu (exo-) Cyclist system (Stratagene) according to the manufacturer's instructions.

	Results

Top Abstract Introduction Materials & Methods Results Discussion References

Kinetic and pharmacological comparisons of NAAG hydrolysis by cloned and native human brain NAALADases. To begin our characterization of the human brain enzyme, samples of human cerebellar membranes from two control cases were assayed for NAAG-hydrolytic activity in parallel with lysates of PSMA-transfected PC3 cells. A substrate-velocity relationship was established for each of the three samples, as shown in figure 1 and table 1. K_m values for the brain samples were similar to cloned PSMA (87 and 100 nM vs. 146 nM) and the NAALADase activity measured previously in the LNCaP prostate cancer cell line (65 nM; Carter et al., 1996). To assess further the similarities of the brain and cloned prostate forms of NAALADase, their relative sensitivities to the NAALADase inhibitors quisqualic acid (Robinson et al., 1987), -NAAG (Serval et al., 1990) and 2-(phosphonomethyl)pentanedioic acid (Jackson et al., 1996) were examined. As shown in figure 2, brain and transfected cell samples displayed comparable concentration-dependent profiles of sensitivity to each of the three compounds with >95% inhibition of NAAG hydrolysis observed at the highest inhibitor concentrations.

View larger version (18K): [in this window] [in a new window]   Fig. 1.   Substrate-velocity relationship for human brain NAALADase and comparison with cloned PSMA expressed in PC3 cells. Triton X-100-solubilized human cerebellar membranes (control cases 3262 and 3547) or PSMA-transfected PC3 cell lysates (PSMA2) were incubated with 2.5 nM radiolabeled NAAG and increasing concentrations of unlabeled NAAG as described in the text. R2 = .9894 (PSMA2), .9944 (3242) and .9932 (3547).

View larger version (23K): [in this window] [in a new window]   Fig. 2.   Pharmacological sensitivities of human brain NAALADase. Human cerebellar membranes and PSMA-transfected lysates were tested for their relative sensitivities to various concentrations of the NAALADase inhibitors quisqualic acid (top), -NAAG (middle) and PMPA (bottom). Assays were conducted at a substrate ([3H]NAAG) concentration of 2.5 nM with samples described in figure 1. Inhibitors were included at concentrations ~1×, ~10× and ~100× the concentrations required for 50% inhibition of the cloned enzyme as determined in preliminary experiments. Results are expressed as percentages of NAALADase activity measured in the absence of inhibitor for each sample.

Northern analyses of human brain RNAs. To compare the RNA species expressed in the human brain with those observed in human prostatic cells (LNCaP cell line), poly(A)⁺ RNA from human brain was hybridized to the NAALADase/PSMA cDNA. As shown in figure 3, similar sets of three RNA bands were observed in all brain and prostatic cell samples. The predominant of these, a 2.8-kb species, is reported to contain the NAALADase/PSMA mRNA represented by the cloned PSMA cDNA (Israeli et al., 1993). Also, the relative amounts of NAALADase-like RNA detected among LNCaP, whole brain, and two region-specific brain isolates corresponded to their respective levels of NAALADase activity: LNCaP > hippocampus > whole brain > cerebellum (Carter et al., 1996; Passani et al., 1997).

View larger version (48K): [in this window] [in a new window]   Fig. 3.   Demonstration by Northern hybridization that PSMA-like RNAs of similar sizes are expressed in human brain- and prostate-derived cells. Electroblots containing RNA samples from the LNCaP prostatic cancer cell line (3.5 µg of total RNA) and human brain [2 µg of poly(A)+ RNA] were hybridized to a radiolabeled PSMA2 cDNA probe. The same set of three bands of hybridization, corresponding to RNAs of ~6.0, ~4.0 and ~2.8 kb in length, is observed in all samples. The predominant species observed in all samples is that of ~2.8 kb, the previously reported size of the PSMA mRNA (Israeli et al, 1993). For comparative analyses (see text), it was assumed that poly(A)+ RNA would be enriched 20-fold for mRNAs of interest because at most one-twentieth of total RNA is composed of mRNA.

Immunoprecipitation of NAALADase activity from brain homogenates using anti-PSMA antibody. Having detected an mRNA in human brain that was approximately the same size as and similar in sequence to PSMA, we explored the detection of the presence of NAALADase protein using the anti-PSMA antibody 7E11-C5. To determine what fraction of total brain NAALADase activity might be composed by PSMA-like immunoreactive species, we assessed the extent of immunoprecipitation of activity by 7E11-C5/Protein A/trisacryl complexes. This involved solubilization of cerebellar membranes with Triton X-100 and subsequent examination of the distribution of NAALADase activity in the supernatant vs. pellet fractions after immunoprecipitation. As shown in figure 4, 82% of NAALADase was removed from the supernatant fraction of the cerebellar membrane isolates via binding to the 7E11-C5 antibody. Control supernatant fractions from which the antibody was omitted retained full activity. Furthermore, NAALADase activity was recovered in the pellets of 7E11-C5-containing samples but not in the antibody-free controls.

View larger version (27K): [in this window] [in a new window]   Fig. 4.   Immunoprecipitation of brain NAALADase activity with anti-PSMA antibody 7E11-C5. A monoclonal antibody directed against PSMA (7E11-C5) was tested for its ability to immunoprecipitate Triton X-100-solubilized fractions of cerebellar membranes from patient 3262. The antibody was preincubated with Protein A/trisacryl beads overnight, washed and then exposed overnight to the solubilized brain protein. Control samples were preincubated without antibody to examine the immunoglobulin specificity of the precipitation. Top, 82% of NAALADase activity is selectively precipitated by incubation with the 7E11-C5-Protein A/trisacryl beads. Bottom, the 7E11-C5-containing pellet possesses NAALADase activity, whereas the control pellet is NAALADase negative.

Cloning of human brain NAALADase cDNAs. To characterize the brain NAALADase species in greater molecular detail, we analyzed brain mRNA [poly(A)⁺-RNA] using RT-PCR. Two primer sets, designed to amplify the 5' and 3' coding regions of the PSMA cDNA, respectively, were tested for their ability to produce specific RT-PCR amplicons. Parallel RT-PCR reactions in which only the brain RNA was omitted served as negative controls. As illustrated in figure 5, two specific products of the expected sizes were amplified by this procedure (one from each primer set). Because the NAALADase/PSMA mRNA is derived from multiple exons (see Discussion), our RT-PCR amplification of these cDNA sequences from brain was not due to chromosomal DNA contamination (the amplification of which would yield much larger products). Subsequent subcloning and sequencing of these cDNAs revealed that they are identical in sequence to the previously cloned PSMA species. These results indicate that human brain NAALADase is composed, at least in part, of a polypeptide identical to PSMA.

View larger version (38K): [in this window] [in a new window]   Fig. 5.   Demonstration by RT-PCR cloning that brain and prostate express a common NAALADase mRNA. First-strand cDNA was synthesized from brain poly(A)+ RNA and amplified using PSMA-derived oligonucleotide primers. The schematic shows the regions of the PSMA against which the primers were directed. An ethidium bromide-stained 1% agarose gel shows the specific amplification of products of the expected sizes, 1219 bp for the 5' cDNA (left) and 1426 bp for the 3' cDNA (right). Control reactions (RNA) show that the amplification is dependent on the addition of brain RNA. Sequence analysis (not shown) confirms that the RT-PCR products are identical in sequence to PSMA. Because the amplified products span multiple mRNA splice junctions, amplification of these species from genomic DNA is not possible.

	Discussion

Top Abstract Introduction Materials & Methods Results Discussion References

PSMA is expressed in human brain. Immunohistochemical analyses with the 7E11-C5 antibody indicated that the expression of PSMA was limited to prostatic and a few other non-neural tissues (Horoszewicz et al., 1987, Silver et al., 1997). These studies implied that human brain NAALADase would be composed of a different polypeptide, which would not be 7E11-C5 reactive. In contrast, molecular studies have provided considerable evidence of similarities between the two species (Israeli et al., 1994; Troyer et al., 1995; Carter et al., 1996, Uría et al., 1997). Previous interpretations of these disparate results led to the hypothesis that a different splice isoform of the enzyme might be expressed in brain. In the present study, the immunoprecipitation and the RT-PCR data clearly indicate that the PSMA polypeptide is expressed in human brain and that the majority of human cerebellar NAALADase is 7E11-C5 immunoreactive. The discovery that PSMA is expressed in brain should not curtail efforts to use PSMA as a prostatic cancer marker and targeting functionality. However, this identity does suggest that the design of therapeutic agents that use PSMA to target cytotoxins or to induce autoimmune responses should take into account any possible adverse effects to the nervous system. An autoimmune therapy for prostate cancer using autologous PSMA peptide-stimulated dendritic cells has thus far shown to be efficacious and without adverse neurological consequences (Tjoa et al., 1997).

Molecular characteristics of human brain NAALADase. By virtue of its newly discovered identity to PSMA, structural information on the human brain NAALADase molecule can be obtained from previous analyses of the prostatic form of the enzyme. The primary amino acid sequence of NAALADase predicts an 84-kDa polypeptide, and Western blots and glycosylation consensus motifs predict a native glycoprotein of ~100 kDa in mass (Israeli et al., 1993; Troyer et al., 1995). NAALADase demonstrates sequence homology to the M28 metallopeptidase family (Rawlings and Barrett, 1997) and thus is inferred to be a cocatalytic zinc peptidase. Homology to the M28 family has also allowed predictions of the overall structure and functional groups of NAALADase within its active site (Rawlings and Barrett, 1997).

The role of NAALADase in the nervous system. Regardless of its use as a prostate cancer marker, NAALADase is an interesting target for pharmacotherapeutic intervention in the nervous system. NAALADase is believed to regulate excitatory neurotransmission by controlling the bioavailability of its abundant neuropeptide substrate NAAG and the peptide's metabolite, glutamate. NAAG can negatively modulate excitatory signaling via activation of inhibitory mGluR3 receptors (Wroblewska et al., 1997) and possibly through inhibition of NMDA receptor channels, at which it is a weak agonist (Sekiguchi et al., 1989; Trombley and Westbrook, 1990; Puttfarcken et al., 1993; Burlina et al., 1994). Metabolism of the peptide by NAALADase yields glutamate itself, an agonist at all glutamatergic receptor subtypes, which conveys predominantly excitatory effects (reviewed in Hollmann and Heinemann, 1994). It is believed that NAALADase activity tips the balance of "NAAGergic" effects toward glutamate generation and thus, presumably, excitation. Consistent with this hypothesis, recent experiments in animal model systems show that NAALADase inhibitors are neuroprotective against excitatory insult (Orlando et al., 1997; Lu et al., 1997), and alterations in NAALADase activity that are consistent with inferred changes in glutamatergic neurotransmission have been observed in patients with amyotrophic lateral sclerosis (Tsai et al., 1991) and schizophrenia (Tsai et al., 1995) and in animal models of epilepsy (Meyerhoff et al., 1992).

Conclusions. By demonstrating the identity between human brain NAALADase and PSMA, we hope to promote the refinement of PSMA-directed therapeutic strategies so as to minimize adverse consequences to the nervous system. The identity of the brain and prostatic tumor NAALADases also raises intriguing questions about the possibly similar functions of the enzyme in neurotransmission and carcinogenesis. Moreover, molecular information about the human brain enzyme may facilitate the development of NAALADase inhibitors as neuroprotective agents.