Introduction

Top Abstract Introduction Materials & Methods Results Discussion References

Previously, asthma was defined as episodic reversible airways obstruction (American Thoracic Society, 1962). It is now appreciated that patients with chronic severe asthma can develop irreversible obstruction of airways (Brown et al., 1984; Juniper et al., 1990). This complication develops from architectural remodeling of the airway wall, resulting in increased smooth muscle mass (Bramley et al., 1994; Lambert et al., 1993) from both hyperplasia and hypertrophy (Ebina et al., 1993), as well as remodeling of other elements. Airway smooth muscle thickening, in turn, may contribute to the nonspecific bronchial hyperresponsiveness characteristic of asthma (James et al., 1988; James et al., 1989; Pare et al., 1991). Airway wall remodeling in asthmatics is often clinically refractory to current bronchodilator and anti-inflammatory therapies, including glucocortoids (Brown et al., 1984; Juniper et al., 1990). New treatment strategies are needed that prevent the occurrence of this process.

DHEA and DHEAS are the major secretory steroidal products of the adrenal gland, but the physiologic role of DHEA remains unknown (Ebeling and Kovisto, 1994). DHEA and its synthetic analogs are antiproliferative in animal tumor models and malignant cell lines (Schwartz et al., 1988a; Schwartz and Pashko, 1995). This action has been explained by inhibition of G6PDH, with subsequent blockade of ribonucleoside and deoxyribonucleoside formation (Dworkin et al., 1986; Garcea et al., 1988; Gordon et al., 1987; Pashko et al., 1991; Schwartz et al., 1988a; Schwartz and Pashko, 1995), or by interference in mevalonic acid biosynthesis, with reduced protein isoprenylation, impaired localization of Ras to the plasma membrane and interruption of Raf-kinase-mediated signal transduction cascades (Schulz and Nyce, 1991; Schulz et al., 1992). Prior study in vascular tissue has demonstrated that accelerated coronary atherosclerosis in the transplanted heart is reduced by treatment with DHEA (Eich et al., 1993). We reasoned that accelerated coronary atherosclerosis could represent a form of remodeling of the vascular wall. Therefore, we investigated the effects of DHEA and its more potent analog 16-BrEA on proliferation of cultured airway smooth muscle to determine whether these steroids might also offer potential as a therapy for remodeling of the airway wall.

	Materials and Methods

Top Abstract Introduction Materials & Methods Results Discussion References

Materials. The following animals, drugs and chemicals were used in this study: male adult Sprague-Dawley rats (Charles River, Raleigh, NC), protease inhibitors and guanidine thiocyanate (Boehringer Mannhein, Indianapolis, IN), DMEM, HBSS, HEPES, antibiotic-antimycotic (10,000 U penicillin, 10,000 U streptomycin and 25 µg amphotericin B/ml) and EDTA solution (GIBCO, Grand Island, NY), FBS (HyClone, Logan, UT), PDGF-AA (R&D Systems, Minneapolis, MN), antibodies for p21^ras (pan-ras, Ab-3, mouse monoclonal) and c-fos (Ab-2, rabbit polyclonal) proteins, HRP-conjugated goat anti-mouse IgG, and A431 cell lysate standard (Calbiochem, San Diego, CA), polyclonal HRP anti-rabbit IgG (Transduction Laboratories, Lexington, KY), M-MLV reverse transcriptase (Life Technologies, Gaithersburg, MD), type 55 polaroid film (Polaroid Corp., Cambridge, MA) and DHEA, 16-BrEA, antibody for -smooth muscle actin and all other materials (Sigma Chemical Co., St. Louis, MO) unless otherwise specified.

Culture of airway smooth muscle. Rat tracheal smooth muscle was cultured as previously reported (Fryer et al., 1997). Briefly, adult male Sprague-Dawley rats were euthanized, and the posterior tracheal membrane was digested twice for 30 min at 37°C in HBSS containing 0.2% type IV collagenase and 0.05% type IV elastase. Enzyme digests were centrifuged at 500 × g, and the pellet was resuspended and cultured in DMEM supplemented with 10% FBS, nonessential amino acids, penicillin (100 U/ml), streptomycin (100 µg/ml) and amphotericin (250 ng/ml) in a humidified atmosphere of 5% CO₂/95% air at 37°C. Upon reaching confluence, cells were passaged with 0.25% trypsin-0.002% EDTA. Immunostaining was performed using a polyclonal antibody against -smooth muscle actin (Sigma) and visualized using an avidin-biotin-immunoperoxidase technique. Smooth muscle cultures demonstrated the typical "hill and valley" appearance under phase-contrast microscopy and stained avidly for -smooth muscle actin. Preliminary studies demonstrated that culture of cells in the presence of 10% FBS resulted in a linear growth phase up to 120 hr. Cultures from passages 2 to 9 were used for experiments.

Measurement of cultured airway smooth muscle proliferation. Proliferation of cultured airway smooth muscle was quantitated using a previously reported colorimetric method based on metabolic reduction of the soluble yellow tetrazolium dye MTT to its insoluble purple formazan by the action of mitochondrial succinyl dehydrogenase (Hirst et al., 1992). This assay empirically distinguishes between dead and living cells. For proliferation studies, cells were seeded into 24-well uncoated plastic plates at 15,000 to 50,000 cells per well and cultured with DMEM and mitogens. After 24 to 96 hr, medium was replaced with 1 ml/well fresh DMEM containing 100 µg/ml MTT and 0.5% FBS, and plates were incubated an additional hour. MTT-containing medium was removed, cells were washed twice with 1 ml of sterile DPBS, 0.5 ml of DMSO was added to each well and the absorbance of the solubilized purple formazan dye was measured at 540 nm on a Shimadzu UV160U spectrophotometer. A total of 4 to 6 wells was studied at each treatment condition. Preliminary studies were performed with 50 to 200 µg/ml MTT incubated for 15 min to 3 hr to determine the optimal concentration and incubation time at which the rate of conversion was linear and proportional to the number of cells present. The absorbance of the MTT formazan reduction product (A₅₄₀) correlated with cell numbers counted by hemocytometer with R² = 0.99. In some experiments, the MTT assay and responses to mitogens and inhibitors were also confirmed by performing cell counts on 10 random fields/well of Giemsa-modified Wright's stained monolayers viewed at 40 power using a 0.01-cm² ocular grid, as previously reported (Fryer et al., 1997).

Cell culture treatments. The effect of DHEA or 16-BrEA on cellular proliferation was studied in cultures stimulated with 0.5% to 10% FBS or 0 to 50 ng/ml PDGF-AA. In some studies, the growth-inhibitory effects of DHEA or 16-BrEA were compared to those of the glucocorticoids dexamethasone or methylprednisolone.

Measurement of cytotoxicity and apoptosis. To assess for cytotoxicity, DHEA or 16-BrEA was added to wells of airway smooth muscle cells previously grown to confluence in DMEM and 10% FBS. After 24 hr, lactate dehydrogenase activity in microfuged supernatant was measured using a commercially available assay (DG-1340K from Sigma). Cell deaths were assessed by trypan blue dye exclusion.

Measurement of G6PDH activity. Cultures were washed three times with cold DPBS on ice, scraped into ice-cold buffer (10 mM MgCl₂ in 50 mM Tris, pH 8.0) and sonicated on ice. G6PDH activity was then assayed by the method of Jones and Andrews (1978).

Immunoblot assay for p21^ras and c-fos proteins. For measurement of p21^ras, cells were washed twice with cold DPBS and swelled on ice for 15 min with 500 µl of cold lysis buffer (10 mM HEPES, 1 mM MgCl₂, 1 mM EDTA, 1 µM pepstatin, 2 µg/ml aprotinin and 1 mM phenylmethylsulfonyl fluoride), as previously reported (Schulz and Nyce, 1991). Cells were then scraped into 1.5-ml polypropylene tubes, homogenized and clarified by centrifugation at 3000 × g for 1 min at 4°C. The postnuclear supernatant was centrifuged at 100,000 × g for 30 min at 4°C. Supernatants were collected, and pelleted membranes were resuspended in detergent buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 1 µM pepstatin, 2 µg/ml aprotinin and 1 mM phenylmethylsulfonyl fluoride in 25 mM Tris, pH 7.4). Aliquots of supernatant and membrane fractions were removed for protein determination using the BCA protein assay. Bromophenol blue and -mercaptoethanol were added to the remaining sample to a final concentration of 0.002% (w/v) and 5% (v/v), respectively. Lysates were then boiled for 5 min at 100°C and stored at 80°C until immunoblotting was performed. For measurement of c-fos protein, monolayers were placed on ice, washed twice with cold DPBS, scraped into 0.5 ml of boiling buffer [10% (v/v) glycerol and 2% (w/v) SDS in 83 mM Tris, pH 6.8] and sonicated. Aliquots were removed for protein determination, bromophenol blue and -mercaptoethanol were added and lysates were boiled as outlined above. Samples were stored at 80°C until immunoblotting was performed. Proteins in defrosted samples were separated by SDS-polyacrylamide gel electrophoresis on 10% polyacrylamide gels for c-fos and 15% gels for p21^ras (15 µg protein/lane), transferred to nitrocellulose and immunoblotted as described previously (Buckley and Whorton, 1994) using 2.5 µg/ml of either pan-ras or c-fos antibodies, the enzyme conjugate anti-mouse IgG/HRP (pan-ras MAb) or anti-rabbit IgG/HRP (c-fos PAb) diluted 1:2000 in blocking buffer as the secondary antibody and an enhanced chemiluminescence detection system (Amersham Life Science, Buckinghamshire, UK).

RT-PCR. Monolayers were washed twice with DPBS, and cells were lysed with 4 M guanidine thiocyanate, 50 mM sodium citrate, 0.05% Sarkosyl and 0.01 M dithiothreitol. After scraping, lysates were sheared with four passes through a 22-gauge needle. RNA was pelleted by ultracentrifugation through 5.7 M cesium chloride and 0.1 M EDTA, as previously reported (Becker et al., 1993). RNA (100 ng) was reverse-transcribed using M-MLV reverse transcriptase. The resultant cDNA was PCR-amplified (Becker et al., 1993) for 29 and 36 cycles for -actin and c-fos, respectively, using rat gene-specific sense and antisense primers based on sequences published in GenBank: -actin, 5' CCATGTGCAAGGCCGGCTTC 3' and 5' GGCCTCGGTGAGCAGCACAG 3'; c-fos, 5' ACTGGATAGAGCCGGCGGAG 3' and 5' GGCTGGTGGAGATGGCTGTC 3', respectively. PCR-amplified DNA was separated on 2% denaturing agarose gel, interchalated with ethidium bromide and visualized and photographed under UV light. The resulting polaroid negative was quantitated using a Bio Image Analyzer (Bio Image, Ann Arbor, MI). The intensity of the -actin cDNA bands (a housekeeping gene unaffected by stimulation with FBS) for each sample was then used to normalize differences between samples.

EMSA. Monolayers were washed twice in cold DPBS and equilibrated 10 min on ice with 0.7 ml of cold CEB (10 mM Tris, pH 7.9, 60 mM KCl, 1 mM EDTA, 1 mM dithiothreitol) with PI (1 mM Pefabloc, 50 µg/ml antipain, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 40 µg/ml bestatin, 3 µg/ml E-64 and 100 µg/ml chymostatin). The detergent NP-40) was added to a final concentration of 0.1%, and cells were dislodged with a cell scraper. Nuclei were pelleted by centrifugation and washed with CEB/PI. Nuclei were then incubated for 10 min on ice in NEB (20 mM Tris, pH 8.0, 400 mM NaCl, 1.5 mM MgCl₂, 1.5 mM EDTA, 1 mM dithiothreitol and 25% glycerol) with PI, spun briefly to clear debris and stored at 80°C until EMSAs were performed EMSAs employed wild-type (5'-TTCCGGCTGACTCATCAAGCG 3' and 3' AAGGCCGACTGAGTAGTTCGC 5') consensus sequences for AP-1 (Lee et al., 1987), end-labeled by phosphorylation with [³²P]-ATP and T4 polynucleotide kinase. DNA-protein binding reactions were performed with 2 µg of nuclear protein (as determined by the Bradford dye binding method) and 0.3 ng of ³²P-end-labeled double-stranded DNA probe incubated 10 min at room temperature in 10 mM Tris, pH 7.9, 50 mM NaCl, 2.5 mM EDTA, 1 mM dithiothreitol, 5 µg bovine serum albumin, 0.1 µg poly dI-dC, and 4% Ficoll. Competition experiments were performed with 10X unlabeled wild-type oligonucleotide sequences. Samples were electrophoresed on a 5% nondenaturing polyacrylamide gel in Tris-glycine-EDTA (TGE; 120 mM glycine and 1 mM EDTA in 25 mM Tris, pH 8.5) buffer. Gels were dried and analyzed by exposure to a phosphorimaging screen (Molecular Dynamics, Sunnyvale, CA).

Statistical analysis. Data are expressed as mean values ± S.E. The minimum number of replicates for all measurements was four, unless otherwise indicated. Differences between multiple groups were compared using one-way analysis of variance. The post-hoc test used was the Newman-Keuls multiple comparison test. Two-tailed tests of significance were employed. Significance was assumed at P < .05.

	Results

Top Abstract Introduction Materials & Methods Results Discussion References

FBS and PDGF promoted airway smooth muscle cell growth in a dose-dependent manner. PDGF was only half as potent as FBS. Endothelin and histamine, however, were much less mitogenic (data not shown). DHEA and its analogs inhibited mitogen-stimulated airway smooth muscle proliferation (fig. 1, A and B). DHEA was more active than DHEAS at high concentrations in cells stimulated by 10% FBS. The analog 16-BrEA was an even more effective inhibitor of FBS-induced cell proliferation than DHEA (fig. 1C) and was more potent than the glucocorticoid dexamethasone (50% inhibitory concentration = 7.5 µM for 16-BrEA vs. 10 µM for dexamethasone), especially at higher concentrations (fig. 1D). In some experiments, decreased metabolism of MTT was shown to be correlated with a reduction in cell numbers (4.3 ± 0.2 with 10% FBS alone vs. 0.3 ± 0.0 with FBS + 250 µM DHEA and 0.2 ± 0.0 × 10⁴ cells per well at 24 hr with FBS + 20 µM 16-BrEA, both P < .001 compared with FBS alone). Neither DHEA nor 16-BrEA was cytotoxic, as measured by LDH activity in supernantant, trypan blue dye exclusion or DNA fragmentation characteristic of apoptosis (data not shown).

View larger version (23K): [in this window] [in a new window]   Fig. 1.   DHEA and analogs inhibit mitogen-stimulated airway smooth muscle proliferation. Cells were cultured with either 10% FBS or 50 ng/ml PDGF, with either 10% FBS or 50 ng/ml PDGF + 5 µl DMSO vehicle and with either 10% FBS or 50 ng/ml PDGF + inhibitors in DMSO added to each well. Proliferation of cultured airway smooth muscle was quantitated by assessing cell number-dependent reduction of the soluble yellow tetrazolium dye MTT to its insoluble purple formazan, measured as the absorbance at 540 nm, (A540) (Hirst et al., 1992). A) Effect of DHEA and DHEAS on FBS-stimulated growth of airway smooth muscle cells after culture for 92 hr. Each bar represents the mean MTT formazan absorbance in 6 to 12 experiments produced by 15,000 cells/well cultured for 92 hr. Similar results were noted in experiments at 72 hr. *P < .001 compared with FBS alone; P < .001 compared with 250 µM DHEAS. B) Effect of DHEA on airway smooth muscle cell proliferation stimulated by PDGF. Each bar represents the mean of four experiments with 50,000 cells/well cultured for 72 hr. *P < .01 compared with 0.5% FBS; P < .001 compared with PDGF alone. C) Effect of the DHEA analog 16-BrEA (BrEA) on FBS-stimulated airway smooth muscle proliferation after culture for 96 hr. Each bar represents the mean of four experiments with 15,000 cells/well cultured for 96 hr. A negative control incubated with 0.5% FBS is also shown for comparison. Similar results were noted in experiments at 48 hr. *P < .001 compared with 0.5% FBS; P < .001 compared with 10% FBS alone. D) Growth-inhibitory effect of 16-BrEA (BrEA) compared with that of dexamethasone (Dex). Each bar represents the mean of 6 to 18 experiments with 50,000 cells/well cultured in 10% FBS for 48 hr. Similar results were observed in experiments performed with methylprednisolone. *P < .001 compared with 10% FBS alone.

DHEA was a more potent inhibitor of G6PDH activity than 16-BrEA in lysates of airway smooth muscle cells (table 1), but 16-BrEA was far more effective than DHEA as an inhibitor of airway smooth muscle proliferation (fig. 1, A vs. C). Also, in contrast to findings in malignant and immortalized cell lines, the addition of ribonucleosides and deoxyribonucleosides to culture medium failed to reverse growth inhibition from DHEA or 16-BrEA (fig. 2, A and B). Taken together, these data suggest that DHEA and 16-BrEA do not impair proliferation of airway smooth muscle cells by disrupting the hexose monophosphate shunt-dependent formation of ribose and deoxyribose sugars needed for RNA and DNA synthesis.

View this table: [in this window] [in a new window]   TABLE 1 Percent inhibition of glucose 6-phosphate dehydrogenase activity in airway smooth muscle lysates by DHEA and 16-BrEA Assays of G6PDH in airway smooth muscle cell lysates were performed on 100 µl of cell lysate, to which inhibitors were added. Activity is expressed as % inhibition of DMSO vehicle-treated controls by 16-BrEA (BrEA) or DHEA). DMSO alone caused no reduction in G6PDH activity under assay conditions. Each value represents the mean of at least three experiments. Methods are described in the text.

View larger version (12K): [in this window] [in a new window]   Fig. 2.   Inhibition of airway smooth muscle proliferation by DHEA (panel A) or 16-BrEA (panel B) is not reversed by supplemental ribonucleosides and deoxyribonucleosides added to culture medium. Cells were cultured and cell numbers were quantitated as described in the text and in figure 1. Each bar represents mean MTT formazan absorbance in four experiments with 50,000 cells/well cultured for 24 hr in DMEM and 10% FBS in the presence or absence of DHEA or 16-BrEA and 200 µM ribonucleosides (R, adenosine, guanosine, cytidine, and uridine) or deoxyribonucleosides (D, deoxyadenosine, deoxyguanosine, deoxycytidine, and thymidine). Similar results were seen at 48 hr. *P < .001 compared with 0.5% FBS; P < .001 compared with 10% FBS alone.

In contrast to findings in cultured colonic adenocarcinoma cells, supplementation of medium with mevalonic acid failed to overcome growth inhibition of airway smooth muscle monolayers by 16-BrEa (fig. 3). Also, treatment with 16-BrEA did not deplete p21^ras in membranes of cultured airway smooth muscle cells (gels not shown). These results suggest that DHEA and analogs do not impair protein isoprenylation in cultured airway smooth muscle. Finally, interference with Ras/Raf-mediated signal transduction would be expected to impair the expression of early-response genes such as c-fos. However, 16-BrEA did not reduce the stimulation of c-fos protein (fig. 4A) or mRNA (fig. 4, B and C) seen normally in response to 10% FBS. These results suggest that DHEA and its analogs do not impair early signal transduction events important in airway smooth muscle for proliferative responses. The normal rise in c-fos mRNA despite treatment with growth-inhibiting doses of 16-BrEA provides additional evidence against the impairment of RNA synthesis via inhibition of G6PDH being the antiproliferative mechanism for these steroids.

View larger version (20K): [in this window] [in a new window]   Fig. 3.   Supplementation of medium with mevalonic acid fails to reverse growth inhibition of airway smooth muscle cells by BrEA, which suggests that disruption of cholesterol metabolism does not explain inhibition of airway smooth muscle growth by 16-BrEA. Cells were cultured and cell numbers were quantitated as described in the text and in figure 1. Each bar represents mean MTT formazan absorbance of six experiments with 50,000 cells/well cultured for 36 hr in with 0.5% FBS, 10% FBS, 10% FBS + 5 µl DMSO vehicle or 10% FBS + inhibitors in DMSO added to each well, in the presence or absence of 6 mM mevalonate in DMEM. Similar results were seen with DHEA. *P < .001 compared with 0.5% FBS; P < .001 compared with 10% FBS with or without mevalonate.

View larger version (44K): [in this window] [in a new window]   Fig. 4.   Expression of early-response genes in airway smooth muscle is not impaired by 16-BrEA. A) Representative immunoblot of c-fos protein from control monolayers treated with 0.5% FBS (lane 2) or 15 min (lanes 3-6), 30 min (lanes 6-8) and 60 min (lanes 9-11) after stimulation with 10% FBS. Cells in lanes 4, 7 and 10 were pretreated with DMSO vehicle 2 hr before stimulation. Cells in lanes 5, 8 and 11 were pretreated with 10 µM 16-BrEA. Lane 1 is an immunoblot of A431 cell lysate. B) Pretreatment for 2 hr with DMSO vehicle or 10 µM 16-BrEA (BrEA) did not prevent the normal increase of c-fos mRNA 30 min after stimulation with 10% FBS. PCR gels of experiments: lanes 1 to 3, 0.5% FBS control; lanes 4 to 6, 10% FBS control; lanes 7 to 9, 10% FBS pretreated with 10 µM 16-BrEA; lanes 10 to 12, 10% FBS pretreated with DMSO vehicle. C) Summary of experiments shown in panel B. Expression of c-fos mRNA is normalized to the housekeeping gene -actin. *P < .05 compared with 0.5% FBS.

Transactivation of secondary-response genes by AP-1 is an important point of convergence of multiple pathways through which many growth factors stimulate cell proliferation. Trans-repression of AP-1 has been shown to account for the antiproliferative effects of glucocorticoids. Although DHEA is not a glucocorticoid, it too has been reported to interact with cytoplasmic steroid receptors. Thus, we considered the possibility that DHEA might also interfere with AP-1-mediated signal transduction processes, leading to inhibition of proliferative responses. Figure 5 shows EMSAs of nuclear protein from airway smooth muscle cells pretreated with DHEA or 16-BrEA for 2 hr before stimulation with 10% FBS. DHEA (fig. 5A) and 16-BrEA (fig. 5B) inhibit DNA binding of AP-1, providing a potential explanation of how these steroids impair airway smooth muscle proliferation. Interruption at this point would be expected to produce inhibition of proliferation in response to a wide variety of mitogens, including PDGF and those found in FBS.

View larger version (110K): [in this window] [in a new window]   Fig. 5.   Treatment of airway smooth muscle with DHEA and 16-BrEA inhibits DNA binding of the transcription factor AP-1. Monolayers were pretreated with DHEA or 16-BrEA for 2 hr and stimulated with 10% FBS. Nuclear protein was isolated after 6 hr, and EMSAs were performed as described in the text. Figures show representative gels from experiments performed at least three times with each inhibitor. A) EMSA of cells pretreated with DHEA: lane 1, 0.5% FBS; lane 2, 10% FBS; lane 3, 10% FBS + 50 µM DHEA; lane 4, 10% FBS + DMSO vehicle. B) EMSA of cells pretreated with 16-BrEA: Lane 1, 0.5% FBS; lane 2, 10% FBS; lane 3, 10% FBS + DMSO vehicle; lane 4, 10% FBS + 2 µM 16-BrEA; lane 5, 10% FBS + 10 µM 16-BrEA. C) EMSA of cells stimulated with 10% FBS. The binding reaction in lane 2 was performed with the same amount of nuclear protein as in lane 1 but in the presence of competition from 10X unlabeled wild-type oligonucleotide sequence for AP-1.

	Discussion

Top Abstract Introduction Materials & Methods Results Discussion References

Airway wall remodeling with potential development of fixed airways obstruction is an important problem among patients with asthma. This complication appears more often in older asthmatics (Brown et al., 1984; Juniper et al., 1990), is not always prevented by currently available therapies (Brown et al., 1984; Juniper et al., 1990) and may contribute significantly to persistent airways hyperresponsiveness (James et al., 1988; James et al., 1989; Pare et al., 1991). Formulation of an effective therapy for this process could represent an important advancement in the treatment of chronic severe asthma. We have shown that proliferation of rat airway smooth muscle cells is substantially reduced by treatment with pharmacologic concentrations of DHEA and its potent analog 16-BrEA (fig. 1). This inhibition was demonstrated both by metabolic assay related to cell number and by a reduction in visual cell counts performed directly. Inhibition of cell proliferation appeared to result from interference with some aspect of the growth cycle, not from cytotoxicity or induction of apoptosis.

The antiproliferative effect of DHEA and its analogs has been previously attributed to inhibition of G6PDH, with impairment in RNA and DNA synthesis from disruption of ribose production by the pentose phosphate pathway (Dworkin et al., 1986; Gordon et al., 1987; Schwartz et al., 1988a; Schwartz and Pashko, 1995), or to disruption of p21^ras membrane localization through interruption of cholesterol metabolism and protein isoprenylation (Schulz and Nyce, 1991; Schulz et al., 1992). These mechanisms have been demonstrated using immortalized or malignant cell lines that may respond differently than primary cultures of airway smooth muscle. In lysates of airway smooth muscle, DHEA was a more potent inhibitor of G6PDH activity than 16-BrEA (table 1), yet 16-BrEA was far more effective than DHEA as an inhibitor of airway smooth muscle proliferation. Furthermore, supplementation of growth medium with ribo- and deoxyribonucleosides did not overcome growth inhibition of cells by DHEA and 16-BrEA, either in our experiments (fig. 2) or in the studies of others (Schulz et al., 1992). Likewise, we demonstrated a normal rise in c-fos mRNA in the presence of growth-inhibiting doses of 16-BrEA (fig. 4, B and C), a result that argues against impairment of RNA synthesis via inhibition of G6PDH as the antiproliferative mechanism for these steroids in airway smooth muscle. Also, supplemental mevalonate did not reverse growth inhibition by 16-BrEA (fig. 3), and treatment with 16-BrEA did not deplete airway smooth muscle membranes of p21^ras. Additionally, the early increase in c-fos mRNA and protein after mitogen stimulation of airway smooth muscle depends in part on both Ras/Raf and MAPK signal transduction cascades (Panettieri, 1997). Treatment of monolayers with growth-inhibiting concentrations of 16-BrEA left normal expression of the early-response gene c-fos intact (fig. 4)further evidence that DHEA and its analogs did not impair important Ras-mediated signal transduction events leading to normal mitogen-enhanced expression of c-fos. These data suggest that neither inhibition of the hexose monophosphate shunt nor that of cholesterol metabolism is an important mechanism of growth inhibition for DHEA and its analogs in cultured rat airway smooth muscle.

DHEA and 16-BrEA decreased DNA binding of the transcription factor AP-1 in EMSAs performed with nuclear protein from treated cells (fig. 5). AP-1 is a heterodimer of the oncogenes c-jun and c-fos or a homodimer of c-jun that binds to the TRE as a late event in multiple mitogenic signaling pathways (Angel and Karin, 1991; Lee et al., 1987). Binding of AP-1 to DNA regulatory sites activates transcription of a variety of target genes that lead to initiation of DNA synthesis and eventually to mitosis (Angel and Karin, 1991). Glucocorticoids inhibit AP-1-dependent gene transcription when AP-1 is composed of either c-jun/c-fos or c-jun/c-jun complexes (Jonat et al., 1990; Pearce and Yamamoto, 1993; Schule et al., 1990; Yang-Yen et al., 1990). Although other explanations have been advanced (Didonato et al., 1996), this inhibition has been proposed to occur by the mechanism of transrepression, from interaction between AP-1 and the glucocorticoid/glucocorticoid receptor unit to form a complex that is incapable of binding to either TRE or the GRE (Angel and Karin, 1991; Adcock et al., 1995a; Heck et al., 1994; Jonat et al., 1990; Pagliogianni et al., 1993; Pearce and Yamamoto, 1993; Schule et al., 1990; Yang-Yen et al., 1990). A high-affinity hormone receptor specific for DHEA has been described in both the cytosol and the nucleus of lymphocytes (Meikle et al., 1992). It is therefore possible that a complex between DHEA or its analogs and this, or one of the so-called orphan receptors (O'Malley, 1990), could inhibit DNA-binding of AP-1 by analogous transrepression. Further studies will be needed to investigate this possibility, including promoter-reporter studies in cells cotransfected with a TRE-containing promoter-reporter construct and an expression vector for the steroid receptor to which DHEA and its analogs bind (Heck et al., 1994). At present we also cannot rule out the possibility that DHEA and 16-BrEA are inhibiting a kinase that mediates AP-1 phosphorylation events necessary for DNA binding (Angel and Karin, 1991; Bernstein et al., 1994; Kyrikis et al., 1994).

In addition to preventing airway smooth muscle proliferation and remodeling, DHEA and it analogs might be useful in reversing acquired glucocorticoid resistance, which results from cytokine-induced overexpression of AP-1 complexes that transrepress the activated glucocorticoid receptor (Adcock et al., 1995b). By binding AP-1, DHEA or an analog/receptor complex might free activated glucocorticoid receptors for attachment to GREs, thus overcoming the relative glucocorticoid resistance of the inflammatory state. Second, many immunoregulatory genes contain AP-1 promoter sites, the inhibition of which could reduce expression of proinflammatory cytokines. Also, DHEA inhibits activation of the transcription factor NF-B (Yang et al., 1993). Thus DHEA and its analogs might have inherent anti-inflammatory activity. Although DHEA itself carries the possibility of unwanted androgenic or estrogenic side effects from metabolism to sex steroids, this complication might be reduced by aerosolizing the drug into the airway or by employing potent 16-fluorinated analogs of DHEA devoid of androgenic or estrogenic activity in animals (Schwartz et al., 1988b). An advantage of these agents over glucocorticoids is their lack of adverse effects on blood pressure and on glucose and bone metabolism (Regelson and Kalimi, 1994). Thus DHEA or its analogs might provide either an alternative to glucocorticoids or an adjunctive in airways diseases.