Introduction

Top Abstract Introduction Methods Results Discussion References

Nicotine acting at neuronal nicotinic AChRs is the primary component of tobacco that drives its habitual use (Benowitz, 1996). It has been hypothesized that smoking a cigarette results in a rapid bolus of nicotine that activates the mesolimbic dopaminergic system producing pleasure and reward, that nicotine slowly builds to a low steady concentration which causes both reversible desensitization and long-term inactivation of AChRs as well as increases in the amounts of some AChR subtypes and that smokers medicate themselves with nicotine to regulate their AChR response (Collins and Marks, 1996; Dani and Heinemann, 1996; Wonnacott et al., 1996).

Nicotine and nicotinic drugs could be important in some neurological diseases because it has been shown that a substantial decrease in nicotinic AChRs is characteristic of both Alzheimer's and Parkinson's disease (Lange et al., 1993; Whitehouse et al., 1988). Epidemiological studies also indicate that smoking may be protective against Parkinson's disease and, to a lesser extent, Alzheimer's disease (Morens et al., 1995). In Parkinson's disease, there is loss of dopamine due to the degeneration of the substantia nigra. It is known that presynaptic AChRs can modulate the release of dopamine (Wonnacott et al., 1996) and that nicotine can be neuroprotective against excitotoxicity (Akaike et al., 1994). These results suggest mechanisms by which nicotine might be protective against Parkinson's disease and by which nicotinic drugs might be therapeutic. The effects of nicotine in several other diseases suggest that nicotinic AChRs may be involved in some way in their pathology or therapy. For example, nicotine from transdermal patches is effective in reducing the severity of Tourette's syndrome (Dursun et al., 1994). As another example, it has been reported that 7 AChRs may be responsible for an attentional deficit that may be a predisposing genetic factor for schizophrenia, that 7 AChRs are reduced in brains of schizophrenia patients and that schizophrenia patients may smoke heavily to self-medicate with nicotine (Freedman et al., 1997).

Along with the synchronized activation of AChRs by a rapid bolus of nicotine, long-term application of this agonist can lead to inactive states of these AChRs, some of which are readily reversible and others of which are not (Collins and Marks, 1996; Dani and Heinemann, 1996; Hsu et al., 1996a; Lester and Dani, 1994; Lukas, 1991). An understanding of the effects of chronic exposure to nicotine on various AChR subtypes might provide better insights into mechanisms of nicotine dependence, tolerance and withdrawal and into the effects of medication with nicotine or nicotinic drugs.

An AChR subtype with the subunit stoichiometry (4)₂ (2)₃ is thought to account for most of the high affinity nicotine binding in brain (Anand et al., 1991; Flores et al., 1992; Lindstrom, 1996; Wada et al., 1989). Nearly equal amounts of a subtype thought to have an (7)₅ subunit stoichiometry are found in brain (Alkondon and Albuquerque., 1993; Anand et al., 1993; Couturier et al., 1990; Del Toro et al., 1994; Lindstrom, 1996; Schoepfer et al., 1990; Seguela et al., 1993). The 7 AChRs are also often found in peripheral ganglion neurons, which also express a mixture of 3 AChR subtypes (Conroy and Berg, 1995). The 3 AChRs are found in brain, although in lower amounts than 42 AChRs or 7 AChRs (Wada et al., 1989). The 3 forms functional AChRs in combination with 2 or 4 subunits (Gerzanich et al., 1995; Papke, 1992), and 5 subunits assemble efficiently with both combinations (Wang et al., 1996). Presumably many subtypes of AChRs are expressed in discrete populations of neurons performing particular functional roles. Many of the AChRs in brain are thought to be located presynaptically and have been implicated in facilitating release of transmitters including ACh, dopamine, glutamate and -aminobutyric acid (Collins and Marks, 1996; Gray et al., 1996; Lena and Changeux, 1997; McGehee and Role, 1995; Wonnacott et al., 1996).

Chronic exposure to nicotine has been shown to differentially affect both the amount and function of neuronal AChR subtypes. Chicken 42 AChRs expressed in Xenopus laevis oocytes or a permanently transfected cell line were shown to double in amount when chronically exposed to nicotine (Peng et al., 1994). The EC₅₀ for upregulation was 0.2 µM, essentially equal to the concentration of nicotine typically found in the serum of smokers (Benowitz et al., 1990). The upregulation was due to a decrease in the rate of destruction of these AChRs resulting from an inactive conformation of these AChRs (Peng et al., 1994). Chronic exposure to high concentrations of nicotine not only reversibly desensitized these AChRs but also permanently inactivated some of them (Peng et al., 1994). Similarly, human 42 AChRs in a permanently transfected cell line were upregulated by chronic nicotine exposure, but the amount of ACh-induced ion flux per AChR was decreased (Gopalakrishnan et al., 1996). The 7 AChRs and the mixture of 3 AChRs expressed by the human neuroblastoma cell line SH-SY5Y increased by 30% and 600%, respectively, in response to chronic exposure to nicotine but only when extremely high concentrations were used (Peng et al., 1997). In a comparison of the electrophysiological responses to a 48-hr exposure to nicotine of rat 42 AChRs expressed in X. laevis oocytes, it was found that nanomolar concentrations of nicotine eliminated most 42 AChR function, whereas micromolar concentrations of nicotine blocked only 50% to 60% of rat 32 AChR responses (Hsu et al., 1996a).

This study compares both the short- and long-term effects of chronic nicotine treatment on electrophysiological function of cloned human 42, 32, 325, 34, 345, 3245, and 7 subunit combinations expressed in X. laevis oocytes. It examines the concentration and time dependence of the responses of these AChR subtypes to acute activation by nicotine and both reversible desensitization and permanent inactivation caused by chronic exposure to nicotine.

	Methods

Top Abstract Introduction Methods Results Discussion References

Cloning of human 4 subunit cDNA. The cDNA encoding the human neuronal AChR alpha4 subunit was obtained by PCR amplification of cDNA synthesized from human brain poly(A)⁺ RNA (Clontech, Palo Alto, CA) with StrataScript RNase H Reverse Transcriptase (Strategene, La Jolla, CA) using two sets of primers (forward, GCCAGCAGCCATGTGGAG; reverse, GCCATCTTATGCATGGACTCGATG) and (forward, TGGGTACGCAGGGTCTTC; reverse, AGCAGGCTCCCGGTCCCTTCC TAG). For subsequent recloning into vector, the product obtained with the first primer set was digested with BsaI and NsiI endonucleases. The product obtained with the second set of primers was digested with only NsiI. The 5 end of this subunit was amplified from 5-RACE-Ready cDNA (Clontech) using Anchor Primer supplied with the kit (CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) and specific 5 reverse primer (GCCACGGGTCGGGACCAC). The 5-end PCR fragment was digested with ClaI and BsaI restrictions enzymes. All PCR fragments were purified by agarose gel electrophoresis using the Geneclean II kit (BIO 101, Vista, CA). The PCR products were ligated together via BsaI and NsiI sites and cloned into the Cla I and EcoRV blunt end sites of the pBluescript II SK⁽⁾ phagemid. The construct was sequenced according to the Sanger method (Sequenase Version 2.0 DNA Sequencing Kit; United States Biochemicals, Cleveland, Ohio) to verify the published sequence of the human 4 AChR subunit (Gopalakrishnan et al., 1996).

In vitro transcription, oocyte isolation and cRNA injection. cDNAs encoding the human 4 and 7 subunits were cloned into a modified SP64T expression vector, 3 and 4 in pcDNAI vector, and 5 and 2 in pSP64A vector, using standard DNA cloning procedures (Melton et al., 1984). cRNA was synthesized in vitro using the Megascript kit (Ambion, Austin, TX).

Purification and immunoabsorption of AChRs from oocytes and solid-phase radioimmunoassays. The purification and immunoabsorption of AChRs from X. laevis oocytes as well as solid-phase radioimmunoassays were used to compare the relative amounts of AChR subunits expressed in oocytes injected with equal amounts of 3, 2, 4 and 5 subunit cRNAs. The procedures for these experiments were as previously described (Peng et al., 1994).

Nicotine treatment and electrophysiological recordings. Currents were measured using a standard two-microelectrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument Corp., Hamden, CT) as previously described (Gerzanich et al., 1995). All recordings were digitized using MacLab software and hardware (AD Instruments, Castle Hill, Australia) and stored on an Apple Macintosh IIcx computer. Data were analyzed using KALEIDAGRAPH (Synergy Software, Reading, PA).

	Results

Top Abstract Introduction Methods Results Discussion References

Acute activation by nicotine. For each AChR type, the concentration-response curves for activation by nicotine and ACh were compared, as shown in figure 1. Table 1 summarizes some of the pharmacological properties of 42, 3 and 7 AChRs.

View larger version (25K): [in this window] [in a new window]   Fig. 1.   Concentration dependence of acute activation of human AChR subtypes expressed in X. laevis oocytes. Oocytes were exposed to consecutive, increasing concentrations of nicotine for 2 to 4 sec while continuously perfusing the recording chamber with saline. Left, inward currents for some representative concentrations; right, concentration-response curves. Concentration-response curves were fitted using a modified Hill equation. Each point represents responses from 4 to 6 oocytes clamped at 70 mV for 42 AChR and 50 mV for both 3 AChRs and 7 AChRs. Peak current responses for each concentration were determined.

View larger version (18K): [in this window] [in a new window]   Fig. 2.   Relative amounts of AChR subunits expressed by injection of equal amounts of 3, 2, 4 and 5 cRNAs. Equal amounts (10 ng) of each subunit cRNA were injected into oocytes. After 3 days, the AChRs were solubilized using Triton X-100. After immunoisolation using large excesses of specific monoclonal antibodies for 3 and 5 subunits (mAb 210), 2 subunit (mAb 290), mouse antiserum to bacterially expressed human 4 or a combination of antibodies to both 2 and 4 subunits, the relative amounts of isolated AChRs were determined using 3H-epibatidine binding.

Long-term inhibition by nicotine. To determine the effects of long-term exposure to nicotine, oocytes were incubated for 48 hr in various concentrations of nicotine. Then, responses from the oocytes were tested using 100 µM ACh as agonist in a perfusing solution that also contained nicotine at the concentration used for incubation. Figure 3 compares the nicotine concentration dependence of chronic inhibition with that for acute activation.

View larger version (23K): [in this window] [in a new window]   Fig. 3.   Comparison of nicotine concentration dependence of chronic desensitization and acute activation. Activation concentration-response curves are the same as in figure 1. For nicotine inhibition, control responses were elicited 3 days after oocyte injection, and oocytes were then incubated for 48 hr at 18°C in concentrations of nicotine varying from 0 to 10 µM. Then, responses were again evoked with 100 µM ACh from each oocyte. The perfusion solution contained nicotine at a concentration equal to the one used for preincubation. Each point represents responses obtained from 4 to 8 oocytes. Current responses were normalized to the maximum response on that day for oocytes not incubated in nicotine.

Time course of nicotine-induced inhibition. Initial control currents were evoked with 100 µM ACh 3 days after injection of cRNA. After incubation of the oocytes in 0.2 µM nicotine, the responses to 100 µM ACh were determined initially in 0.2 µM nicotine and again after a 1-hr rinse in nicotine-free saline to permit recovery from reversible desensitization. At each time point, responses were compared with those of control oocytes that were incubated without nicotine. At all prolonged times of incubation in nicotine, ACh-evoked responses were decreased with respect to control oocytes. Results from these experiments are shown in figure 4.

View larger version (38K): [in this window] [in a new window]   Fig. 4.   Time course of nicotine-induced functional inactivation. Three days after injection of cRNA, initial control currents were evoked with 100 µM ACh. The oocytes were then incubated for various times in 0.2 µM nicotine. Test responses were measured immediately after incubation in nicotine and again after 1 hr of washout. Currents obtained for both inhibition and recovery were normalized to those of oocytes incubated without nicotine. Each bar represents the mean of responses obtained from 3 to 5 oocytes.

View larger version (33K): [in this window] [in a new window]   Fig. 5.   Nicotine-induced inactivation of separate 3 AChR subtypes. Recordings were performed after 3-hr incubation in 0.2 µM nicotine. Each bar represents the mean of the responses to 100 µM ACh normalized to the initial responses before incubation (n = 7 for each).

Time course of recovery after long-term incubation in nicotine. We also considered the time course of recovery of response after a 28-hr incubation in 0.2 µM nicotine, as shown in figure 6. At this point, 72 hr had elapsed since the oocytes were injected with cRNA, and their ability to synthesize new AChRs was probably substantially reduced due to decay of this cRNA. The limited recoveries observed after prolonged washing suggest that in these oocytes, most of the desensitization observed after 24-hr incubation reflects permanent inactivation and there was little synthesis of new AChRs.

View larger version (38K): [in this window] [in a new window]   Fig. 6.   Time course of recovery from functional inactivation after 24-hr incubation in nicotine. Injected oocytes were incubated in 0.2 µM nicotine at 18°C for 24 hr after control responses were obtained with 100 µM ACh. At the end of the 24-hr period, responses were tested again. After this, oocytes were incubated in saline, and the recovery from inactivation was recorded at various times for up to 24 hr. Responses obtained in the oocytes after incubation in nicotine were normalized to averaged control responses from oocytes (n = 6) incubated in nicotine-free medium. Each response shown represents recordings from 3 to 6 oocytes.

	Discussion

Top Abstract Introduction Methods Results Discussion References

We found that prolonged exposure to nicotine affects three major human neuronal nicotinic AChR subtypes differently; 42 AChRs and 7 AChRs were substantially inactivated by prolonged exposure to nicotine, but 3 AChR subtypes were not.

The 42 AChRs exhibited the highest sensitivity for acute activation by nicotine (EC₅₀ = 300 nM) and, correspondingly, were efficiently desensitized by 48-hr incubation in low concentrations of nicotine. The much lower concentrations of nicotine required for chronic inactivation than acute activation presumably reflect the gradual accumulation of AChRs in a high affinity desensitized conformation, which can occur without necessarily gating the AChRs. After 3 hr in 0.2 µM nicotine, the response of 42 AChRs to a saturating concentration of ACh was virtually eliminated, and it recovered negligibly after washing for 1 hr, suggesting that irreversible desensitization had occurred. Hsu et al. (1996a) agree that chronic exposure to nM concentrations of nicotine inhibits the response of 42 AChRs but not 32 AChRs and that micromolar concentrations of nicotine eliminate the response of 42 AChRs. Differences in species and methods make quantitative comparisons with their IC₅₀ values difficult. We incubated with nicotine for 48 hr starting 48 hr after injection of oocytes with human 42 cRNAs and found that 17 nM nicotine caused a 50% reduction in the response to 100 µM ACh compared with untreated oocytes. They reported that after incubation with nicotine for 48 hr starting 48 hr after injection with rat 42 cRNAs, 0.11 nM nicotine caused a 50% reduction in the response to 0.7 µM nicotine compared with the initial responses of these oocytes. Their reported IC₅₀ value changed to 1.9 nM if the oocytes were incubated with nicotine starting 24 hr after cRNA injection.

Oocytes injected with equal amounts of cRNAs for 3, 2, 4 and 5 subunits to model the mix of 3 AChRs found in chick ciliary ganglia (Conroy and Berg, 1995) and several rat or human neuroblastoma cell lines (Lukas et al., 1993; Wang et al., 1996) were found to express a mixture of 2 and 4 subunit-containing 3 AChRs rather than a homogeneous population of AChRs containing all four subunits. The 3 AChRs exhibited 10-fold lower sensitivity for acute activation by nicotine and were 50-fold less efficiently desensitized by 48-hr incubation in low concentrations of nicotine (IC₅₀ = 870 nM) than were 42 AChRs. In the presence of 0.2 µM nicotine, 32 AChRs and 325 AChRs were inhibited by ~50% in their response to 100 µM ACh, whereas 34 AChRs and 345 AChRs were not significantly inhibited. This probably reflects the higher sensitivity for activation by nicotine for 32 AChRs (EC₅₀ = 6.8 µM) and 325 AChRs (EC₅₀ = 1.9 µM) than for 34 AChRs (EC₅₀ = 106 µM) and 345 AChRs (EC₅₀ = 105 µM) (27). Even after 3 hr in 0.2 µM nicotine, the response of 3 AChRs to a saturating concentration of ACh recovered completely after 1 hr of washing, in contrast with the almost total loss of 42 AChR response.

The 7 AChRs exhibited the lowest sensitivity for acute activation by nicotine of the three subtypes (EC₅₀ = 40,000 nM), 13-fold lower than 3 AChRs and 133-fold lower than 42 AChRs. However, 7 AChRs were the most sensitive of the three subtypes to inactivation by 48-hr incubation in low concentrations of nicotine (IC₅₀ = 2.8 nM), probably reflecting the rapid desensitization characteristic of 7 AChRs (Alkondon and Albuquerque, 1993; Couturier et al., 1990; Gerzanich et al., 1994, 1995; Lindstrom, 1996; Peng et al., 1993; Seguela et al., 1993). The 7 AChRs were 6-fold more sensitive than 42 AChRs and 310-fold more sensitive than 3 AChRs.

EC₅₀ values for activation by ACh and nicotine of cloned human 42 AChRs and 7 AChRs determined here using a set of glass tubes to ensure rapid application agree well with values obtained for these cloned AChRs by others using a millisecond-resolution multibarrel puffer technique on transfected cells (Buisson et al., 1996; Gopalakrishnan et al., 1995).

Irreversible inactivation may be related to AChR up-regulation, which is another phenomenon associated with chronic exposure of nicotinic AChRs to nicotine. Previously, we showed that the upregulation of 42 AChRs occurs due to a decrease in AChR turnover that could be associated with a change in AChR conformation not associated with channel opening (Peng et al., 1994). It is not clear whether this conformation is identical to a reversibly desensitized or an irreversibly inactivated conformation. It is clear that despite an increase in the number of AChRs as a result of chronic exposure to nicotine, there is a net decrease in function of 42 AChRs and 7 AChRs. Recent findings also show that sustained exposure of 42 AChRs to nicotine increases the phosphorylation of the 4 subunit (Hsu et al., 1996b; Molinari et al., 1996). Further investigations of this mechanism may lead to a clearer picture of the relationship between the AChR conformations and post-translational modifications associated with up-regulation and those associated with functional inactivation.

The tolerance to increased nicotine doses that is characteristic of tobacco users (Benowitz, 1996; Collins and Marks, 1996; Dani and Heinemann, 1996) can be explained by the net decreases in 42 AChR and 7 AChR function that we have observed after chronic exposure to nicotine. These decreases in function occur despite an increase in the amount, especially of 42 AChRs, induced by chronic exposure to nicotine (Peng et al., 1994, 1997). Permanent inactivation of 4 or 7 AChRs coupled with a slow rate of resynthesis may account for the weeks of benefit reported for Tourette's syndrome patients treated for only 2 days with transdermal nicotine patches (Dursun et al., 1994). A particularly good example of nicotine acting in vivo as a time-averaged antagonist is the effect of nicotine on prolactin release in the rat (Hulihan-Giblin et al., 1990a, 1990b; Sharp and Beyer, 1986). A single intravenous injection of nicotine causes an increase in serum prolactin concentration as a result of activating AChRs in the hypothalamus. This response desensitizes rapidly and for a long duration, resulting in little or no response 1 or 6 hr later. Chronic treatment with nicotine by injections twice a day for 10 days prevented any acute response to nicotine despite provoking an increase in hypothalamic [³H]ACh binding sites. After this chronic nicotine treatment, 8 to 14 days were required for the response to acute nicotine treatment and the amount of AChR to return to normal, presumably as a result of turnover of permanently inactivated AChRs.

Gene knockout experiments also suggest that it is reasonable to think that chronic exposure to nicotine in tobacco users could be associated with the net loss of 42 AChR and 7 AChR function but not great neurological impairment. Knockout of the 2 subunit gene in mice eliminates the high affinity binding of nicotine in the brain that would be expected from the loss of 42 AChRs (Picciotto et al., 1995). Knockout of the 7 subunit gene in mice eliminates the high-affinity binding of -bungarotoxin in brain that would be expected from 7 AChRs (Orr-Urtreger et al., 1996). In neither case do these knockout mice exhibit gross behavioral or anatomic anomalies.

In a chronic smoker with a typical serum concentration of nicotine of 0.2 µM (Benowitz et al., 1990), virtually all 42 AChRs would be inactivated, as would 90% of their 7 AChRs, but only 20% of their 3 AChRs would be inactivated, and only these could quickly recover as the serum nicotine concentration dropped after a few hours without smoking. Thus, the behavioral effects and reward of smoking are likely to depend on the inactivation of 42 AChRs and 7 AChRs while leaving 3 AChRs available to respond to the micromolar boluses of nicotine available quickly after inhalation of smoke (Benowitz, 1996). The first cigarette of the morning is generally regarded as the most rewarding (Benowitz, 1996), which might result either from increased sensitivity or resynthesis of 42 AChRs and 7 AChRs after overnight abstinence or as a relief from withdrawal symptoms as these two AChR subtypes are quickly returned to their chronically inactivated states. Neuronal synaptic mechanisms can be complex. In ciliary ganglia, postsynaptic 3 AChRs combine with perisynaptic 7 AChRs to contribute to a high safety factor for neurotransmission, and neurotransmission can occur even if the 7 AChRs are blocked with -bungarotoxin (Zhang et al., 1996). At this type of synapse, the 7 AChR component of the postsynaptic current would be blocked by the chronic presence of nicotine, but transmission could still occur through 3 AChRs.

The 4 (Wada et al., 1989) and 7 AChRs (Cimino et al., 1992; Del Toro et al., 1994; Seguela et al., 1993) are expressed in many areas of the brain, whereas 3 AChRs can be found mostly in the peripheral nervous system (McGehee and Role, 1995; Orr-Urtreger et al., 1996; Wada et al., 1989; Whiting et al., 1991). In the brain, 3 AChRs have been thought to be localized to areas known to be directly involved in the reward mechanisms of drug abuse, including the locus ceruleus, ventral tegmental area and substantia nigra (Wada et al., 1989). Recent evidence, however, suggests that many of the dopamine-containing regions of the brain associated with addiction or Parkinson's disease may in fact contain 6 rather than 3 (LeNovere et al., 1996). The 6 subunits are closely related to 3 subunits in sequence. Their ability to function as parts of AChRs has only recently been demonstrated (Gerzanich et al., 1997). The 64 AChRs were found to differ pharmacologically from 34 AChRs, with nicotine behaving as an 18% partial agonist with a prolonged inhibitory effect. Therefore, investigations of the acute and chronic effects of nicotine on 6 AChRs will be important in the future. It remains to be determined which AChR subtypes are associated with particular components of the behavioral responses to chronic exposure to nicotine and how these AChR subtypes act by presynaptic and postsynaptic mechanisms in various circuits to produce these behavioral effects.